Sequence report of a strain of Babesia bigemina isolated in cattle from the Girón Municipality, Azuay, Ecuador

  • Jorge Gualberto Bustamante–Ordóñez Universidad de Cuenca, Facultad de Ciencias Agropecuarias. Cuenca, Ecuador - Universidad del Zulia, Facultad de Ciencias Veterinarias. Maracaibo, Venezuela
  • Diego Andrés Bustamante–Guzmán Universidad de Cuenca, Facultad de Ciencias Químicas. Cuenca, Ecuador
  • Sergio Emiro Rivera-Pirela Universidad del Zulia, Facultad de Ciencias Veterinarias. Maracaibo, Venezuela
Keywords: Babesia bigemina, Babesia bovis, Rhipicephalus microplus, Giemsa smear, PCR–RFLP, qRT–PCR, Sanger sequencing

Abstract

In this study, the ab1 files obtained from Sanger sequencing (forward and reverse) were used to perform sequence assembly and analysis. For this, the Staden Package software (version 2.0b10) was used, which consists of two programs: Pregap4 and Gap4. Pregap4 was responsible for quality analysis and data preparation, while Gap4 performed assembly, verification, read pair analysis, contig editing, and confidence calculation of the consensus sequence. BLASTn was used to identify possible homologs (Babesia bovis and B. bigemina). Sequence–based sequencing of the 18S gene of B. bigemina, using the oligonucleotides For: PIRO A (5'–TACCCAATCCTGACACACAGGG–3') y PIRO B (5'–TTAAATACACGAATGCCCCCCCAAC–3'), which obtained a band of approximately 393 bp, revealed the nucleotic distribution of a strain designated as 4623Ba.bi_GIR–E, of B. bigemina. The product yielded a sequence of 369 bp (>H230420–007_C05_46_Oligo1.ab1) and 371 bp (>H230420–007_I07_46_Oligo2.ab1). B. bigemina was isolated from the peripheral blood of infected crossbred cattle, positive for Giemsa smear, PCR–RFLP and qRT–PCR, from the Municipality of Girón in the Province of Azuay, Ecuador, located at greather than 2,000 meters above sea level, which shares high homology, greather than 98 %, with several sequences of B. bigemina reported in Ecuador, Latin American Countries such as Colombia, Brazil, revealing possible origins of the pathogen and, with the sequences of B. bigemina published isolated in extra–continental latitudes, thus corroborating the genomic stability of the parasite .

Downloads

Download data is not yet available.

References

Alvarez JA, Rojas C, Figueroa JV. Diagnostic tools for the identification of Babesia sp. in persistently infected cattle. Pathog. [Internet]. 2019; 8(3):143–157. doi: https://doi.org/m2hj

Enríquez S, Guerrero R, Arrivillaga–Henríquez J, Araujo P, Villacrés E, Enríquez A., Benítez–Ortíz W. New records of ticks of genus Amblyomma Koch, 1844 (Acari: Ixodidae) for Ecuador. Acta Parasitol. [Internet]. 2020; 65:430–440. doi: https://doi.org/m2hm

Retamales–Castelletto E, Manzo–Garay V. Recomendaciones para la tinción de frotis sanguíneos para la lectura del hemograma [Internet]. Santiago, Chile: Instituto de Salud Pública de Chile; 2018 [consultado 20 Ago. 2023]. 14 p. Disponible en: https://goo.su/W1CeUm

Abdela N, Ibrahim N, Begna F. Prevalence, risk factors and vectors identification of bovine anaplasmosis and babesiosis in and around Jimma town, Southwestern Ethiopia. Acta Trop. [Internet]. 2018; 177:9–18. doi: https://doi.org/m2hn

Carret C, Walas F, Carcy B. Grande N, Précigout É, Moubri K, Schetters TP, Gorenflot A. Babesia canis canis, Babesia canis vogeli, Babesia canis rossi: Differentiation of the Three Subspecies by a Restriction Fragment Length Polymorphism Analysis on Amplified Small Subunit Ribosomal RNA Genes. J Eukaryot. Microbiol. [Internet]. 1999; 46(3):298–303. doi: https://doi.org/drjrcd

Soberanis–Bernal PJ, Castañeda–Arriola RO, Figueroa–Millán JV, Rojas–Martínez C, Lira–Amaya JJ, Álvarez–Martínez JA, Santamaría–Espinosa RM, Martínez–García G. Aplicación de una prueba de PCR–RFLP en el diagnóstico de la infección por Babesia spp. en bovinos. Estudio retrospectivo. En: Da Silva LF, De Oliveira VC, comps. Ciencias agrarias: Estudios sistemáticos e investigación avanzada 3 [Internet]. Ponta Grossa, Paraná, Brasil: Atena Editora; 2023. p. 70–89. doi: https://doi.org/m2xj

Allsopp MT, Visser ES, du Plessis JL, Vogel SW, Allsopp BA. Different organisms associated with heartwater as shown by analysis of 16S ribosomal RNA gene sequences. Vet. Parasitol. [Internet]. 1997; 71(4):283–300. doi: https://doi.org/dv9b5v

Allsopp MT, Allsopp BA. Molecular sequence evidence for the reclassification of some Babesia species. Ann. N. Y. Acad. Sci. [Internet]. 2006; 1081(1):509–517. doi: https://doi.org/ctkv9t

Criado–Fornelio A, Buling A, Casado N, Gimenez C, Ruas J, Wendt L, Rosa–Farias N, Pinheiro M, Rey–Valeiron C, Barba–Carretero JC. Molecular characterization of arthropod–borne hematozoans in wild mammals from Brazil, Venezuela and Spain. Acta Parasitol. [Internet]. 2009; 54(3):187–193. doi: https://doi.org/bxdssx

Durrani AZ, Kamal N. Identification of ticks and detection of blood protozoa in friesian cattle by polmerase chain reacton test and estimation of blood parameters in district Kasur, Pakistan. Trop. Anim. Health Prod. [Internet]. 2008; 40:441–447. doi: https://doi.org/bwxhft

Luo J, Yin H, Liu Z, Yang D, Guan G, Liu A, Ma M, Dang S, Lu B, Sun C, Bai Q, Lu W, Chen P. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences. Vet. Parasitol. [Internet]. 2005; 133(1):1–6. doi: https://doi.org/b3wvfq

M’ghirbi Y, Bouattour A. Detection and molecular characterization of Babesia canis vogeli from naturally infected dogs and Rhipicephalus sanguineus ticks in Tunisia. Vet. Parasitol. [Internet]. 2008; 152(1–2):1–7. doi: https://doi.org/c3spzf

Salih DA, El Hussein AM, Seitzer U, Ahmed JS. Epidemiological studies on tick–borne diseases of cattle in Central Equatoria State, Southern Sudan. Parasitol. Res. [Internet]. 2007; 101:1035–1044. doi: https://doi.org/dmf2f4

Reddy GR, Chakrabarti D, Yowell CA, Dame JB. Sequence microheterogeneity of the three small subunit ribosomal RNA genes of Babesia bigemina: expression in erythrocyte culture. Nucleic Acids Res. [Internet]. 1991; 19(13):3641–3645. doi: https://doi.org/chd66v

Holland PM, Abramson RD Watson R, Gelfand DH. Detection of specific polymerase chain reaction product by utilizing the 5'––––3'exonuclease activity of Thermus aquaticus DNA polymerase. Proc. Natl. Acad. Sci. U.S.A. [Internet]. 1991; 88(16):7276–7280. doi: https://doi.org/cmpfrs

Brayton KA., Lau AOT, Herndon DR, Hannick L, Kappmeyer LS, Berens SJ, Bidwell SL, Brown WC, Crabtree J, Fadrosh D, Feldblum T, Forberger HA, Haas BJ, Howell JM, Khouri H, Koo H, Mann DJ, Norimine J, Paulsen IT, Radune D, Ren Q, Smith Jr. RK, Suarez CE, White O, Wortman JR, Knowles Jr. DP, McElwain TF, Nene VM. Genome sequence of Babesia bovis and comparative analysis of apicomplexan hemoprotozoa. PLoS pathog. [Internet]. 2007; 3(10):e148. doi: https://doi.org/fqkf64

Ray BK, Bailey CW, Jensen JB, Carson CA. Chromosomes of Babesia bovis and Babesia bigemina. Mol. Biochem. Parasitol. [Internet]. 1992; 52(1):123–126. doi: https://doi.org/cczhx5

Universidad de Cuenca, GAD Municipal de Girón. Plan de Desarrollo y Ordenamiento Territorial del Cantón Girón (2015–2019). Tomo I. Diagnóstico medio físico [Internet]. 2021 [Consultado 22 Ago. 2022]; Cap. 2.1. p. 2.1.1–2.1.96. Disponible en: https://goo.su/5UdkAjT

Arboleda–García MA. Diagnóstico molecular y prevalencia de Babesia spp. mediante PCR–RFLP en ganado bovino de la provincia de Manabí – Ecuador. [tesis de maestría en Internet]. Sangolquí, Ecuador: Universidad de las Fuerzas Armadas ESPE; 2019 [consultado 10 Mar. 2023]. 72 p. Disponible en: https://goo.su/x7jE

Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain–terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. [Internet]. 1977; 74(12):5463–5467. doi: https://doi.org/dgsrk5

Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. [Internet]. 2018; 35(6):1547–1549. doi: https://doi.org/gd39d8

Chávez–Larrea MA, Cholota–Iza C, Medina–Naranjo V, Yugcha–Díaz M, Ron–Román J, Martin–Solano S, Gómez–Mendoza G, Saegerman C, Reyna–Bello A. Detection of Babesia spp. in High Altitude Cattle in Ecuador, Possible Evidence of the Adaptation of Vectors and Diseases to New Climatic Conditions. Pathog. [Internet]. 2021;10(12):1593–1606. doi: https://doi.org/mrkj

Published
2024-06-12
How to Cite
1.
Bustamante–Ordóñez JG, Bustamante–Guzmán DA, Rivera-Pirela SE. Sequence report of a strain of Babesia bigemina isolated in cattle from the Girón Municipality, Azuay, Ecuador. Rev. Cient. FCV-LUZ [Internet]. 2024Jun.12 [cited 2026May9];34(2):6. Available from: https://produccioncientifica.luz.edu.ve/index.php/cientifica/article/view/42270
Section
Veterinary Medicine