Received: 15/07/2025 Accepted: 03/10/2025 Published: 14/10/2025 1 of 10 https://doi.org/10.52973/rcfcv-e35751 Revista Científica, FCV-LUZ / Vol. XXXV ABSTRACT The object of this study was to determine the occurrence of ampicillin–resistant (Amp R) Enterococcus spp. isolated from raw milk and chicken (Gallus gallus domesticus) meat samples focus on their antimicrobial resistance profiles and virulence genes from Sivas province, Türkiye. A total of 210 samples comprising raw milk (n = 150; cow (Bos taurus), sheep (Ovis aries) and buffalo (Bubalus bubalis) milk) and fresh chicken pieces (n = 60; thighs and wings with skin) were collected and analyzed. Antimicrobial susceptibility testing was performed using the disk diffusion method, while minimum inhibitory concentrations for Amp R isolates were determined by broth microdilution. Polymerase chain reaction identified the isolates at the species level and screened for key virulence genes (asa1, cylA, esp, gelE and hyl). A total of 40 strains of Amp R Enterococcus spp. were isolated from raw milk and chicken meat samples. Out of the isolates from raw milk and chicken meat, 67.5% were identified as E. faecium, 12.5% as E. faecalis, and 20% as other Enterococcus species. Among the Amp R Enterococcus spp. isolates, minimum inhibitory concentration values ≥ 16 μg·mL -1 were detected in 25.0% of isolates from milk and 30.0% of isolates from chicken meat samples. Disk diffusion revealed varied resistance among isolates, with the highest against erythromycin (55.0%) and tetracycline (50.0%), followed by rifampin (42.5%), ciprofloxacin (20.0%), vancomycin (12.5%), gentamicin (10.0%), and chloramphenicol (7.5%). Amp R Enterococcus spp. isolates exhibited a multidrug resistance rate of 67.5%. Virulence gene analysis indicated the presence of the asa1 gene in only one E. faecalis isolate (2.5%), while cylA, esp, gelE and hyl genes were not detected. Detection of antibiotic–resistant Enterococcus spp. in raw milk and chicken meat, and occurrence of vancomycin and gentamicin resistant enterococci are noteworthy for public health concerns. Monitoring the antimicrobial–resistant enterococci in animal–derived foods is crucial within the framework of the One Health concept. Key words: Antimicrobial resistance; ampicillin resistant Enterococcus spp.; milk; chicken meat; one health RESUMEN El objetivo de este estudio fue analizar la presencia de Enterococcus spp. resistentes a la ampicilina aislados en muestras de leche cruda y carne de pollo (Gallus gallus domesticus), centrándose en sus perfiles de resistencia antimicrobiana (Amp R) y genes de virulencia de la provincia de Sivas, Turquía. Se recolectaron y analizaron 210 muestras de leche cruda (n = 150; leche de vaca (Bos taurus), oveja (Ovis aries) y búfala (Bubalus bubalis)) y piezas frescas de pollo (n = 60; muslos y alas con piel). Se realizaron pruebas de susceptibilidad antimicrobiana mediante el método de difusión en disco, mientras que las concentraciones mínimas inhibitorias para los aislados de resistencia a la ampicilina se determinaron mediante microdilución en caldo. La reacción en cadena de la PCR identificó los aislados a nivel de especie y analizó los genes de virulencia clave (asa1, cylA, esp, gelE e hyl). Se aislaron 40 cepas Enterococcus spp. Amp R a partir de muestras de leche cruda y carne de pollo. De los aislados de leche cruda y carne de pollo, el 67,5 % se identificó como E. faecium, el 12,5 % como E. faecalis y el 20 % como otras especies de Enterococcus. Entre los aislados de resistencia a la ampicilina Enterococcus spp., se detectaron valores de concentraciones mínimas inhibitorias ≥ 16 μg·mL -1 en el 25,0 % de los aislados de leche y el 30,0 % de los aislados de muestras de carne de pollo. La difusión en disco reveló resistencia variada entre los aislados, con las más altas, la eritromicina (55,0 %) y tetraciclina (50,0 %), seguida de rifampicina (42,5 %), ciprofloxacino (20,0 %), vancomicina (12,5 %), gentamicina (10,0 %) y cloranfenicol (7,5 %). Los aislados de Amp R Enterococcus spp. exhibieron una tasa de resistencia a múltiples fármacos del 67,5 %. El análisis de genes de virulencia indicó la presencia del gen asa1 en un solo aislado de E. faecalis (2,5 %), mientras que no se detectaron los genes cylA, esp, gelE ni hyl. La detección de Enterococcus spp. resistentes a antibióticos en leche cruda y carne de pollo, así como la presencia de enterococos resistentes a la vancomicina y la gentamicina, son importantes para la salud pública. El monitoreo de enterococos resistentes a antimicrobianos en alimentos de origen animal es crucial en el marco del concepto “Una Salud”. Palabras clave: Resistencia a los antimicrobianos; Enterococcus spp.; resistentes a la ampicilina; leche; carne de pollo; “Una Salud” Determination of the Ampicillin–Resistant Enterococcus strains, antibiotic resistance and virulence genes in raw milk and chicken meat samples from Sivas province, Türkiye Determinación de cepas de Enterococcus resistentes a la ampicilina, resistencia a antibióticos y genes de virulencia en muestras de leche y carne de pollo de la provincia de Sivas, Turquía Seyda Şahin 1 * , Mahmut Niyazi Moğulkoç 2 , Sema Ağaoğlu 3 1 Sivas Cumhuriyet University, Faculty of Veterinary Medicine, Department of Food Hygiene and Technology. 58140, Sivas, Türkiye. 2 Sivas Cumhuriyet University, Faculty of Veterinary Medicine, Department of Microbiology. 58140, Sivas, Türkiye. 3 Sivas Cumhuriyet University, Faculty of Veterinary Medicine, Department of Food Hygiene and Technology. 58140, Sivas, Türkiye. *Corresponding author: seydasahin@cumhuriyet.edu.tr

Ampicillin resistant Enterococcus in milk and chicken samples / Şahin et al.______________________________________________________ 2 of 10 INTRODUCTION Enterococcus spp. is considered a typical flora component of the human and animal gastrointestinal systems, however in recent years it has come into being as one of the most prevalent causes of nosocomial and opportunistic infections in patients [1]. The rising relevance of Enterococcus spp. in hospital acquired infections is due to their capacity to acquire resistance to various classes of antimicrobials [2]. Recent directives from the European Commission Implementation Decision 2020/1729 indicate that Enterococcus faecalis (E. faecalis) and Enterococcus faecium (E. faecium) should also be monitored within the scope of reporting antimicrobial resistance [3]. Enterococcus spp. are significant contributors of nosocomial infections in humans and recognized for their intrinsic resistance to multiple antibiotics [4, 5]. Moreover, acquired resistance to β–lactam, aminoglycoside, tetracycline, erythromycin, fluoroquinolone, chloramphenicol, and glycopeptide antibiotics is frequently reported [6]. Severe invasive enterococcal infections are often treated with a cell–wall–active drug (e.g. ampicillin and vancomycin) and an aminoglycoside (gentamicin or streptomycin). Resistance to these antibiotics reduces the effectiveness of combination therapy [7]. E. faecium, especially among Enterococcus spp., has gained resistance to antibiotics such as aminoglycoside, ampicillin and vancomycin, making infection treatment more challenging [8, 9]. The prevalence of infections caused by Ampicillin–Resistant (Amp R ) Enterococcus spp. has risen during the 1980s. Currently, over eliminate 90% of E. faecium strains isolated from nosocomial infections have been found to be resistant to ampicillin. Furthermore, most nosocomial invasive E. faecium isolates in Europe exhibited resistance to ampicillin [10, 11]. Foodborne Enterococcus spp. are not typically considered pathogens, yet they can establish themselves in the gastrointestinal tract [12]. The prevalence of clinical infections caused by Enterococcus spp. has steadily increased during the 1970s [13, 14, 15]. The most common Enterococcus spp. encountered in humans are E. faecalis and E. faecium, which are responsible for a great deal of healthcare–associated infections [16]. Resistance to conventional medications, such as ampicillin, has made treating E. faecalis and E. faecium complicated. Concerns over public health risks have raised consumer awareness of the importance of consuming safe raw milk and retail chicken (Gallus gallus domesticus) meat. Raw milk and chicken meats are frequently contaminated with Enterococcus spp., and rising interest in the epidemiology of these pathogens continues globally [17]. Studies concerning the emergence of Amp R Enterococcus spp. in foods are growing by the day, which is particularly crucial in terms of nosocomial infections worldwide [18]. The prevalence of Enterococcus spp. in different animal–derived foods in Türkiye has been studied [19, 20, 21, 22], however, no investigation has been conducted on the characterization of Amp R Enterococcus isolates. Accordingly, the purpose of this study was to determinate the presence of Amp R Enterococcus spp. strains isolated from raw milk and chicken samples offered for consumption in Sivas, as well as their antimicrobial susceptibility profiles and virulence genes. MATERIALS AND METHODS Sampling of milk and chicken meat samples A total of 210 samples comprising raw milk [(n = 150; cow (Bos taurus), sheep (Ovis aries) and buffalo (Bubalus bubalis) milk)] and fresh chicken pieces (n = 60; thighs and wings with skin) were collected from multiple supermarkets, butcher, and retail sale points located in the center of Sivas province, Türkiye, between 2022 and 2023. Raw milk samples (approximately 250–500 mL) offered for sale were collected into sterile bottles in a random manner from local sale points. Packaged fresh chicken pieces (between 500–1,000 g) from diverse companies from various supermarkets, butcher and local sales points were gathered on a regular basis in Sivas province. The samples were promptly delivered to the laboratory under (Laboratory Cooler Box, 32 L, China) cold chain conditions (+ 4°C) and processed on the day of collection. In accordance with the study’s objectives, sample collection was completed when the number of Amp R Enterococcus spp. isolates reached n = 40. Isolation and identification of Enterococcus spp. To isolate the Enterococcus spp., 10 mL raw milk and 10 g of chicken meat samples were placed in sterile bags were diluted with sterile Enterococcus enrichment broth (Oxoid CM0984, United Kingdom) as 1:10 ratio under aseptic conditions. The prepared homogenate was enriched by incubation (Binder GmbH BD 115, Germany) at 35–37°C for 24 hours (h). A 0.1 mL aliquot of the homogenate was taken and spread on Enterococcus Agar (Oxoid CM0985, United Kingdom), then incubated for 48 h at 37ºC under aerobic conditions. Following incubation, colonies of a black color, measuring 1 mm in diameter, suspected of Enterococcus spp. were selected and passed onto 5% Sheep Blood Columbia Agar (CBA, Oxoid CM0331, United Kingdom). Presumptive Enterococcus spp. isolates were kept at -20°C in (Bosch Deep Freezer GSN33VWE0N, Poland) Brain Heart Infusion Broth (BHI, Oxoid CM1135, United Kingdom) supplemented with 20% glycerol to ensure preservation for further analysis. Extraction of total genomic DNA from bacterial isolates Within the scope of the study, n = 40 Amp R Enterococcus spp. strains were isolated from raw milk and chicken pieces. DNA extraction from these isolates was performed using the typical boiling method. To achieve this, pure colonies grown on blood agar were suspended in 200 μL of nuclease–free water and incubated at 95°C for 10 min. The samples were then centrifuged (Thermo Scientific Micro CL17 Microsantrifuge, Waltham, MA USA) at 13,000 g, and 120 μL of the supernatant was transferred to Eppendorf tubes and stored at -20°C (Bosch Deep Freezer GSN33VWE0N, Poland) for subsequent analysis [23]. PCR analysis for the confirmation of Enterococcus spp. In this study, DNA samples obtained from Enterococcus strains isolated from milk and chicken meat were analyzed for species–

_________________________________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol.XXXV 3 of 10 specific tuf genes using conventional polymerase chain reaction (PCR), (Turbo–Cycler Lite, Blue–Ray, Biotech, Taiwan) [24]. For species–level delineation of Enterococcus spp. PCR was performed using two pairs of primers unique to the ddl gene of E. faecalis and E. faecium. All primer sequences utilized in the investigation are included in the TABLE I. A negative control consisted of water devoid of Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA), whereas a positive control was DNA extracted from the E. fecalis ATCC 29212 strain. (C; 30 μg), Ciprofloxacin (Cip; 5 μg), Erythromycin (E; 15 μg), Gentamicin (Cn; 120 μg), Rifampin (Rd; 5 μg), Tetracycline (Te; 30 μg), and Vancomycin (Van; 30 μg) (Oxoid Antibiotic Disks, United Kingdom) [28, 29]. E. faecalis ATCC 29212 served as a positive control throughout the research. The MIC values of strains (n=40) previously defined to Amp R (≤ 16 R) Enterococcus isolates by the disk diffusion method were evaluated using the broth microdilution technique [29]. Following the recommended 48-h incubation for enterococci, the growth in the wells of the plate was evaluated, the growth and sterility control wells were examined, and the MIC values of the reference organism (E. faecalis ATCC 29212) and isolates were obtained and recorded. The MIC values of the isolates were assessed in accordance with CLSI [29] guidelines. A loopful (10 μL) was taken from the growth control well and inoculated onto Blood Agar, and the colony morphologies were assessed on the subsequent day. For Enterococci, ampicillin MIC values of ≤ 8 μg·mL -1 were considered as susceptible and ≥ 16 μg·mL -1 as resistant [29]. RESULTS AND DISCUSSION A total of 40 Amp R Enterococcus spp. strains were recovered from raw milk and chicken meat samples in this study. Among the species isolated from these samples, 67.5% (n=27/40) were classified as E. faecium, 12.5% (n=5/40) as E. faecalis, and 20% (n=8/40) as other Enterococcus spp. The species–level distribution of Amp R Enterococcus isolates revealed that 4 (20.0%) were E. faecalis and 10 (50.0%) were E. faecium in milk samples, on the other hand 1 (5.0%) was classified as E. faecalis and 17 (85.0%) as E. faecium in chicken meat samples (TABLE III). For PCR amplification, a total of 25 µl of PCR reaction was prepared as follows: 12.5 µL of 2× master mix containing Taq DNA polymerase, dNTP mix, MgCl2, and reaction buffer (FIREPol® Master Mix, Solis BioDyne, Tartu, Estonia), 0.5 µL of 10 pmol of each primer pair, 1 µL of target DNA (5–100 ng·µL -1 ) and 10.5 µL of DNA/RNA–free water were added. The PCR procedure consisted of 35 cycles, beginning with a 3 min initial denaturation at 95°C, followed by 30 s of denaturation at 95°C, 30 s of annealing at 55°C, 1 min of extension at 72°C, and a final 7 min DNA synthesis at 72°C [25, 26]. From the obtained PCR products, 10 µL of DNA sample and 5 µL of loading dye were mixed and loaded onto the gel. Amplicons were separated via electrophoresis in a 1.5% agarose gel (Vivantis LE Grade Agarose Gel, Malaysia) at 90 volts and 500 mA electric current for 50 min. The presence of the amplicons was visualized under UV light by means of a transilluminator (Vilbert Loumart, ECX–F26.M, France). Determination of virulence genes by multiplex PCR (mPCR) For the detection of the presence of particular virulence genes (asa1, cyl, esp, gelE, and hyl) implicated in colonization, adhesion, and invasion in Enterococcus spp. isolates, mPCR was conducted with primers targeted to these genes (TABLE II). [27]. Determination of antibiotic susceptibility profiles The antimicrobial susceptibility profiles of Enterococcus isolates were assessed by the Kirby–Bauer disk diffusion method [28, 29]. Bacterial suspensions were standardized to a 0.5 McFarland density with the aid of a densitometer (Biosan Den–1, Latvia) and subsequently spread onto Mueller Hinton Agar (MHA; Oxoid, CM0337, United Kingdom) by means of a sterile cotton swab. In order to define the antimicrobial susceptibility profiles of Enterococcus isolates, eight antibiotic disks were placed on to the MHA surface, including Ampicillin (Amp; 10 μg), Chloramphenicol TABLE I Primer sequences used for the confirmation of Enterococcus spp. in this study No Target Gene Primer Sequence (5’-3’) Base Pair (bp) Reference 1 Tuf TACTGACAAACCATTCATGATG AACTTCGTCACCAACGCGAAC 112 Ke et al. [24] 2 ddlE. faecalis ATCAAGTACAGTTAGTCTTATTAG ACGATTCAAAGCTAACTGAATCAGT 941 Kariyama et al. [25] 3 ddlE. faecium TTGAGGCAGACCAGATTGACG TATGACAGCGACTCCGATTCC 658 Cheng et al. [26] TABLE II Primer sequences of virulence genes used in this study No Target Gene Primer Sequence (5’-3’) Base Pair (bp) 1 asa1 GCACGCTATTACGAACTATGA TAAGAAAGAACATCACCACGA 375 2 gelE TATGACAATGCTTTTTGGGAT AGATGCACCCGAAATAATATA 213 3 cylA ACTCGGGGATTGATAGGC GCTGCTAAAGCTGCGCTT 688 4 esp AGATTTCATCTTTGATTCTTGG AATTGATTCTTTAGCATCTGG 510 5 hyl ACAGAAGAGCTGCAGGAAATG GACTGACGTCCAAGTTTCCAA 276 TABLE III Distribution of Ampicillin–Resistant Enterococcus spp. positive isolates and species in raw milk and chicken meat samples (%) Sample Number of Amp R1 E. faecalis E. faecium Other Enterococcus spp. 2 Milk 20 4 (20.0) 10 (50.0) 6 (30) Chicken meat 20 1 (5.0) 17 (85.0) 2 (10) Total 40 5 (12.5) 27 (67.5) 8 (20.0) 1 Amp R : Phenotypically obtained Ampicillin–resistant isolates. 2 Other Enterococcus spp.: Enterococcus strains identified other than E. faecalis and E. faecium

Ampicillin resistant Enterococcus in milk and chicken samples / Şahin et al.______________________________________________________ 4 of 10 Enterococcus spp. have gradually evolved from commensal bacteria due to their natural antimicrobial resistance abilities and virulence potential, inflicting to life threatening hospital–acquired infections worldwide. Although Enterococcus is commensal bacteria, it is the primary opportunistic pathogen in the digestive systems of humans and animals [30]. Multidrug resistance (MDR) enterococci represent a significant threat due to the possibility of spreading these resistant infections directly or indirectly from food producing animals to humans. According to results of the studies conducted globally, the prevalence of Enterococcus spp. is high in animal–derived foods [31, 32]. Studies on isolates of Enterococcus spp. have demonstrated that E. faecalis and E. faecium are the most commonly encountered species, followed by E. durans, E. hirae, E. gallinarum, and E. casseliflavus [21, 31, 33, 34, 35]. Indeed, in this study, of the Amp R resistant strains observed in the milk and chicken meat samples, 12.5% were E. faecalis and 67.5% were E. faecium. The discrepancies obtained from all these investigations may be attributed to the origin, geographical differences, study period, sampling method, initial contamination of samples, farm, milking and personnel hygiene and methodological differences. A limitation of our study is that these factors were not controlled, which may have influenced our results. In the 1980s, high–level resistance to ampicillin and vancomycin emerged in hospitals across the United States, leading to outbreaks and an increase in healthcare–associated infections caused by E. faecium strains resistant to both antibiotics. Ampicillin and vancomycin are the key antibiotics for managing enterococcal infections [36]. Clinical strains, on the other hand, frequently have distinct adaptation traits and are resistant to both antibiotics, and these strains are reported to be both metabolically and virulently enriched [37]. Indeed, ampicillin resistance has been reported to be high in adults in clinical isolates regardless of geographic origin [38]. In this study, disk diffusion and then microdilution methods were used to determine the ampicillin resistance of Enterococcus strains. Joste et al. [39] investigated phenotypic Amp R E. faecium strains in their study, suggested that disk diffusion test results should be confirmed by microdilution method and reported that MIC results revealed more accurate results. Although investigation confirmed that all isolates exhibited ampicillin resistance phenotype (100%) by the disk diffusion technique, eleven of the isolates tested had MIC values more than or equal to 16 μg·mL -1 , which is considered as the cut–off value [29]. Six (35.3%) Amp R E. faecium isolated from chicken meat samples and two (20%) isolates from milk samples had MIC values greater than 16 μg·mL -1 . Joste et al. [39] recommend using the broth microdilution method to determine the MIC values of E. faecium strains that exhibit to be resistant by the disk diffusion method, notably in severe infections to accurately detect ampicillin resistance. Indeed, in line with the purpose of this study, a total of 40 phenotypically Amp R resistant isolates were obtained from milk and chicken meat samples, genes specific to penicillin–binding proteins (such as PBP5) were not examined, as a limiting facet of this study, we didn’t perform sequence analysis to elucidate the mechanisms responsible for ampicillin resistance due to financial constraints, however, previous studies have indicated that multiple mutations in the active site of the PBP5 was the common mechanism for high– level ampicillin resistance [40, 41]. Penicillin–binding proteins, like PBP5, play a vital role in the construction of the bacterial cell wall, also serve as targets for β–lactam antibiotics and therefore, it is significant to investigate them in Enterococcus spp. isolates. High–level resistance to β–lactams in E. faecium was found to be associated with the expression of PBP5 [42]. It is stated that ampicillin resistance in E. faecium has low–level resistance based on increased amounts of PBP5 with low affinity to beta–lactams (MIC 8 to 64 mg·L -1 ) and high–level resistance based on mutation in PBP5 with high MICs of 16 mg·L -1 [39]. MIC values of all Amp R isolates were determined using the broth microdilution method in the present study. The MIC profiles of the isolates were evaluated in accordance with the CLSI (2020) criteria. The results for isolates with ampicillin MIC values of 16 μg·L -1 or above are presented in TABLE IV. The MIC values of five Amp R strains (two E. faecium and three other Enterococcus spp.) derived from milk samples, as well as six strains (E. faecium) collected from chicken meat samples, were revealed to be ≥ 16 μg·mL -1 (TABLE IV). Of the Amp R Enterococcus spp isolates obtained from milk samples, 5 (25.0%) exhibited MIC values of ≥ 16 μg·mL -1 , 4 (20%) demonstrated MIC values of 4 μg·mL -1 , 8 (40%) indicated MIC values of 2 μg·mL -1 , and 3 (15%) had MIC values below 1 μg·mL -1 . Among the Amp R Enterococcus spp isolates derived from chicken meat samples, 6 (30.0%) exhibited MIC values of ≥ 16 μg·mL -1 , 1 (5%) showed a MIC of 8 μg·mL -1 , 9 (45%) had MICs of 4 μg·mL -1 , 2 (10%) recorded MICs of 2 μg·mL -1 , and 2 (10%) presented MIC values below 1 μg·mL -1 . The Amp R Enterococcus spp. isolates in this investigation had MIC values ranging from 32 µg·mL -1 to >512 µg·mL -1 (TABLE IV). Amp R Enterococcus spp. isolates derived from milk and chicken meat samples exhibited varying MIC values. The MIC range of Amp R isolates obtained from milk samples (32 – >512 μg·mL -1 ) was wider than the isolates obtained from chicken meat samples (32 – 256 μg·mL -1 ). This phenomenon may indicate a higher level of ampicillin resistance in Enterococcus spp. isolates obtained from milk samples. In contrast to this study, Morandi et al. [32]. reported that the Enterococcus spp. strains isolated from milk and feces differed significantly, and all strains were susceptible to Amp as well as the antibiotics daptomycin, Cn, teicoplanin, and Van in MIC results. Among Amp R Enterococcus spp. isolates derived from raw milk and chicken meat samples, 80.0% of E. faecalis (n=5) isolates were resistant to rifampin, 40.0% to Cn, 20.0% to E and C. However, resistance to Cip, Te and Van were not detected in any E. faecalis isolates. Of the E. faecium isolates (n=27), 74.1% were resistant to E, 70.4% to Te, 7.4% to C, Cip, and Cn, and 3.7% to Rd and Van. In other Amp R Enterococcus isolates (n=8), 62.5% resistance was detected to Rd, 50% to Van, 37.5% to Cip, 12.5% to E and Te. Furthermore, it was shown that the Amp R Enterococcus spp. isolates (n=40) obtained from raw milk and chicken meat samples revealed a 67.5% (27/40) of MDR (a resistance pattern that encompasses at least one antibiotic, from three or more distinct antibiotic categories). Within the scope of the study, one strain obtained from chicken meat was phenotypically resistant to six antibiotics: Amp, E, C, Cn, Rd and Te (AmpECCnRdTe) (TABLE V).

_________________________________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol.XXXV 5 of 10 In the current study, resistance to vancomycin, a glycopeptide antibiotic, was detected in 12.5% (n=5/40) of Amp R Enterococcus spp. isolates. In a study conducted in Egypt by Hammad et al. [43] vancomycin resistance in raw milk samples was reported as 91.6%. Results from previous studies conducted in Ireland, Türkiye, and Italy that either failed to delineate Vancomycin–Resistant Enterococcus (VRE) in raw milk and its products or identified VRE at low levels [20, 44, 45] contradict with these researchers’ findings (91.6%). Similar to the current study, 5% of enterococcal isolates obtained from cheese in Egypt were discovered to be resistant to vancomycin, but vancomycin resistance genes were not detected in these isolates [46]. This dramatic wane can be attributed to the prohibition on antibiotic use in animal production since 2006, as the widespread use of avoparcin as a growth promoter in animal production facilities has contributed to the rise of VRE in humans, animals, and animal products [47]. VRE prevalence in European countries has markedly declined since 2006, when the use of avoparcin in animal production facilities was outlawed in the European Union [48, 49]. Similarly, studies conducted in Türkiye have also noted the presence of vancomycin–resistant enterococci in animal production [41, 50]. For instance, Aslantaş [41] reported ampicillin resistance in 3.3% (11 isolates) and vancomycin resistance in 1.5% (5 isolates) of Enterococcus spp. isolates derived from broilers. These findings accentuate the efficacy of antibiotic usage policies in mitigating the spread of resistant microorganisms. Enterococci strains have been reported that they can develop intrinsic resistance to different classes of antibiotics, such as aminoglycosides, β–lactams, cephalosporins, lincosamides and trimethoprim–sulfamethoxazole at low or high levels [41, 51]. Numerous studies have designated the worldwide frequency of antibiotic–resistant enterococci in animal derived foods [32, 52, 53]. In this study, a substantial proportion of Amp R Enterococcus spp. isolates exhibited resistance to erythromycin, tetracycline, and rifampin. Consistent with this study, high–level of tetracycline resistance in E. faecium isolates from milk and chicken meat has also been reported in countries such as Türkiye [52, 54], Korea [34], Italy [32], Iran [53] and Spain [55]. The results of this study indicated that Amp R E. faecalis and E. faecium isolates exhibited significant resistance to the majority of the antibiotics tested. In this study, the majority of HighLevel Gentamicin Resistant (HLGR) and Amp R enterococci isolated from raw milk and chicken meat samples were resistant to more than one antibiotic class. Infections caused by MDR Enterococcus are a significant global public health issue and it is critical to monitor TABLE IV Minimum inhibitory concentrations of ampicillin–resistant Enterococcus spp. isolates collected from milk and chicken meat samples (µg·mL -1 ) Species No. (%) at MIC (μg·mL -1 ) Ampicillin MIC Value (≥16 μg·mL -1 ) Sample <1 2 4 8 16 32 64 128 256 >512 E. faecalis (n= 5) Milk (n= 4) 1 (25.0) 2 (50.0) 1 (25.0) – – – – – – – – Chicken meat (n= 1) 1 (1.0) – – – – – – – – – – E. faecium (n= 27) Milk (n= 10) 2 (20.0) 5 (50.0) 1 (10.0) – – – 1 (10.0) – – 1 (10.0) 2 (20.0) Chicken meat (n= 17) 1 (5.9) 1 (5.9) 8 (47.1) 1 (5.9) – 2 (11.8) 2 (11.8) – 2 (11.8) – 6 (35.3) Other Enterococcus spp. (n= 8) Milk (n= 6) – 1 (16.7) 2 (33.3) – – 1 (16.7) – 1 (16.7) 1 (16.7) – 3 (50.0) Chicken meat (n= 2) – 1 (50.0) 1 (50.0) – – – – – – – – Total Enterococcus spp. (n= 40) 5 (12.5) 10 (25.0) 13 (32.5) 1 (2.5) – 3 (7.5) 3 (7.5) 1 (2.5) 3 (7.5) 1 (2.5) 11 ( 27.5) n: number of Amp R isolates MIC values of ≤ 8 μg·mL -1 represents Ampicillin susceptible, ≥16 g·mL -1 indicates Ampicillin resistance according to CLSI [29]. MIC values highlighted in bold demonstrate ampicillin–resistant strains TABLE V Antibiotic Resistance Profiles of Ampicillin–Resistant Enterococcus spp. Strains Isolated from Raw Milk and Chicken Meat (%) Antimicrobial Agent E. faecalis (n=5) E. faecium (n=27) Other Enterococcus spp. (n=8) Total (n=40) S R S R S R S R Ampicillin (Amp, 10 µg) – 5 (100) – 27 (100) – 8 (100) – 40 (100) Chloramphenicol (C, 30 μg) 4 (80.0) 1 (20.0) 25 (92.6) 2 (7.4) 8 (100) – 37 (92.5) 3 (7.5) Ciprofloxacin (Cip, 5 µg) 5 (100) – 25 (92.6) 2 (7.4) 5 (62.5) 3 (37.5) 32 (80.0) 8 (20.0) Erythromycin (E, 15 μg) 4 (80.0) 1 (20.0) 7 (25.9) 20 (74.1) 7 (87.5) 1 (12.5) 18 (45.0) 22 (55.0) HLGR (Cn, 120 μg) 3 (60.0) 2 (40.0) 25 (92.6) 2 (7.4) 8 (100) – 36 (90.0) 4 (10.0) Rifampin (Rd, 5 µg) 1 (20.0) 4 (80.0) 26 (96.3) 1 (3.7) 3 (37.5) 5 (62.5) 23 (57.5) 17 (42.5) Tetracycline (Te, 30 µg) 5 (100) – 8 (29.6) 19 (70.4) 7 (87.5) 1 (12.5) 20 (50.0) 20 (50.0) Vancomycin (Van, 30 μg) 5 (100) – 26 (96.3) 1 (3.7) 4 (50.0) 4 (50.0) 35 (87.5) 5 (12.5) HLGR: High level gentamicin resistance S: Susceptible R: Resistant

Ampicillin resistant Enterococcus in milk and chicken samples / Şahin et al.______________________________________________________ 6 of 10 them within the scope of the one health concept. The widespread distribution of Enterococcus spp., along with contributing factors like genomic adaptability and extensive antibiotic usage, seems to have played a role in the recent emergence of E. faecium and E. faecalis as MDR pathogens [15]. A multifaceted one health concept is required to elucidate the relationship between antimicrobial use and antimicrobial resistance across the human, animal, and environmental settings, in order to conduct a comprehensive investigation into the current landscape of antimicrobial resistance. HLGR was detected in 10.0% of Amp R Enterococcus spp. isolates from raw milk and chicken meat samples. In this investigation, Amp R E. faecalis strains were discovered to be 80% resistant to Rd, 40% to HLGR, and 20% to E and C among the antimicrobials tested. In E. faecium strains, resistance was found to be 74.1% to Erythromycin, 70.4% to Te, 7.4% to Cip and C, and 3.7% to Rd and Van, respectively. Nasiri and Hanifian [53] reported an HLGR rate of 26.1% in E. faecalis isolates using the disk diffusion technique. Their usage for the treatment of enterococcal infections is crucial due to the development of high–level resistance to gentamicin and streptomycin [56, 57]. HLGR resistance is critical for the success of therapeutic treatment efficacy, as gentamicin is utilized in combination with antibiotics that target the cell wall in the management of enterococcal infections. However, these combinations will not be effective in the treatment of HLGR enterococcal infections [58]. The development of resistance to other antibiotic classes, including erythromycin and tetracycline, has been reported as a common feature among enterococci isolated from animal derived foods in many previous studies [20, 21, 22, 35, 46, 59]. In the current study, 47.5-55.0% of enterococcal isolates were revealed to be resistant to E and Te, respectively. Additionally, low level of resistance to C (7.5%) was found in this study. The antibiotic resistance profile obtained from the investigation was largely similar with studies implemented on raw milk and chicken meat samples [21, 23, 35, 60]. The high resistance of enterococci isolated from animal–derived foods to Te has previously been attributed to the widespread use of this antibiotic in veterinary medicine [46]. Antibiotic susceptibility profiles according to species in Amp R Enterococcus spp. strains (n=40) isolated from raw milk and chicken meat samples revealed that 80.0% were resistant to Rd, 40.0% to Cn, and 20% to E and C in E. faecalis isolates (n=5). However, resistance was not detected to Cip, Te and Van in any E. faecalis isolates. On the other hand, isolates of E. faecium (n=27) exhibited resistance to 74.1% for E and 66.7% for Te. Van resistance was detected in 3.7% of these isolates. The distribution of antibiotic resistance profiles exhibited by Amp R Enterococcus spp. strains isolated from raw milk and chicken meat samples is presented in Table VI according to the respective species. In addition, the sample–based distribution of phenotypic resistance profiles of E. faecalis, E. faecium, and other Enterococcus spp. strains of Amp R Enterococcus isolates recovered from raw milk and chicken meat samples is presented in Table VI. E. faecalis isolates collected from milk samples were discovered to be resistant to Amp and Rd but sensitive to Cip, E, C, Cn, Van, and Te. E. faecalis isolates from chicken meat samples were found to be resistant to Amp, E, C, Cn, and Rd, but sensitive to Cip, Te, and Van. E. faecium isolates obtained from milk samples demonstrated resistance rates of 60% to Rd, 50% to E, 20% to Te, 10% to Van. Furthermore, it was established that these isolates were susceptible to Cip and C. E. faecium isolates derived from chicken meat samples exhibited 100% resistance to Te, 88.2% to E, and 11.8% to both Cip and C. This notwithstanding, these isolates were discovered to be susceptible to Van (TABLE VI). HLGR was detected in 4 out of 40 Amp R Enterococcus isolates (40%). HLGR was identified in 1 E. faecalis isolate, 2 E. faecium isolates, and 1 other Enterococcus isolate. Besides, this investigation identified five vancomycin–resistant isolates. It was detected in 4 of the Amp R Enterococcus isolates (20%) derived from milk samples and in 1 isolate (5%) obtained from chicken meat samples (TABLE VI). In this study, 19 of Enterococcus spp. isolates were discovered to be phenotypically resistant to tetracycline. Resistance to E, Rd, and Te is frequently detected in both E. faecalis and E. faecium isolates. Resistance to E, Rd and Te is frequently detected in both E. faecalis and E. faecium isolates when other routinely used antibiotics are TABLE VI Sample based patterns of antibiotic resistance profiles in Ampicillin–Resistant Enterococcus spp. Strains (%) Antimicrobial Agent Species / susceptibility category E. faecalis (n=5) (%) E. faecium (n=27) (%) Other Enterococcus spp. (n=8) (%) Total (n=40) (%) Milk (n=4) Chicken meat (n=1) Milk (n=10) Chicken meat (n=17) Milk (n=6) Chicken meat (n= 2) Milk (n=20) Chicken meat (n= 20) S R S R S R S R S R S R S R S R Ampicillin (Amp, 10 µg) – 4 (100) – 1 (100) – 10 (100) – 17 (100) – 6 (100) – 2 (100) – 20 (100) – 20 (100) Chloramphenicol (C, 30 μg) 4 (100) – – 1 (100) 10 (100) – 15 (88.2) 2 (11.8) 6 (100) – 2 (100) – 20 (100) – 17 (85) 3 (15) Ciprofloxacin (Cip, 5 µg) 4 (100) – 1 (100) – 10 (100) – 15 (88.2) 2 (11.8) 2 (33.3) 4 (66.7) – 2 (100) 16 (80) 4 (20) 16 (80) 4 (20) Erythromycin (E, 15 μg) 4 (100) – – 1 5 (50) 5 (50) 2 (11.8) 15 (88.2) 6 (100) – 1 (50) 1 (50) 15 (75) 5 (25) 3 (15) 17 (85) HLGR (Cn, 120 μg) 4 (100) – – 1 (100) 9 (90) 1 (10) 16 (94.1) 1 (5.9) 5 (83.3) 1 (16.7) 2 (100) – 18 (90) 2 (20) 18 (90) 2 (20) Rifampin (Rd, 5 µg) – 4 (100) – 1 (100) 4 (40) 6 (60) 16 (94.1) 1 (5.9) 1 (16.7) 5 (83.3) 2 (100) – 5 (25) 15 (75) 18 (90) 2 (20) Tetracycline (Te, 30 µg) 4 (100) – 1 (100) – 8 (80) 2 (20) – 17 (100) 6 (100) – 1 (50) 1 (50) 18 (90) 2 (20) 2 (20) 18 (90) Vancomycin (Van, 30 μg) 4 (100) – 1 (100) – 9 (90) 1 (10) 17 (100) – 3 (50) 3 (50) 1 (50) 1 (50) 16 (80) 4 (20) 19 (95) 1 (5) HLGR: High level gentamicin resistant, S: Susceptible, R: Resistant

_________________________________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol.XXXV 7 of 10 considered. Particular antibiotics evaluated in this study (such as Rd) and classified by the World Health Organization (WHO) [61] are among the antibiotic classes that are critically important for the treatment of VRE infections. There is no data relative to the usage of these antibiotics in veterinary medicine in Türkiye. In this study, 25.0% of the isolates were found to be resistant to rifampin. It was observed that E. feacalis (80.0%) isolates exhibited higher resistance to rifampin than E. faecium (3.7%). Within the scope of this study, Amp R Enterococcus spp., E. faecalis, and E. faecium isolates were subjected to mPCR analysis in order to determine the presence of several key virulence genes, namely asa1, cylA, esp, gelE and hyl. In this study, the asa1 gene was identified in a single E. faecalis isolate (1/40; 2.5%). Upon examination of the virulence genes, the asa1 gene was identified only in an E. faecalis isolate derived from chicken meat. However, the gelE, cylA, esp and hyl genes were not identified in any of the Amp R Enterococcus spp. isolates. The present study investigated the presence of several key virulence genes (asa1, gelE, cylA, esp, and hyl) in Enterococcus spp. isolates. The presence of virulence factors does not necessarily indicate that strains isolated from animal–derived foods lead to diseases; however, it has been suggested that strains containing these virulence factors may have pathogenic potential and contribute to the severity of infection [62, 63]. Previous studies have reported that a number of virulence genes such as gelE, esp, hyl, and asa1 were frequently detected in Enteroccoccus spp. strains isolated from raw milk samples [31, 33, 34, 43]. The presence of virulence genes in E. faecalis and E. faecium isolates, such as esp (enterococcal surface protein), hyl (hyaluronidase), and gelE (gelatinase), has been linked to intestinal colonization, host tissue invasion, and translocation through epithelial cells [43]. The aggregation substance encoded by asa1 is an enterococcal surface protein that facilitates bacterial conjugation by promoting the formation of bacterial aggregates. It has been stated that asa1 may increase the frequency of transfer of antimicrobial resistance and virulence genes to recipient cells [64]. In this study, asa1, one of the virulence genes, was only found in 2.5% of an E. faecalis strain isolated from chicken meat sample. gelE, cylA, esp, andhyl virulence genes were not found in any of the Amp R Enterococcus spp. isolates studied. It has been reported that cylA, which is responsible for virulence properties associated with the production of active cytolysin, is detected in a small number of isolates [31]. It is known that the esp gene is associated with biofilm production, endocarditis and nosocomial infections [34, 65]. The results obtained from this study were also in accordance with previous studies [34, 43]. Indeed, a study comparing the virulence characteristics of enterococcal strains of diverse origins revealed that those associated with food–borne strains had the lowest incidence of virulence and pathogenicity [66]. CONCLUSIONS According to the findings of this investigation, the presence of multidrug resistant Enterococcus spp. strains in raw milk and chicken meat samples suggests a potential source of contamination for humans. The occurrence of Enterococcus spp. strains exhibiting resistance to multiple antibiotic classes in raw milk and chicken meat samples warrants monitoring due to their potential health risks to people. The presence of multidrug–resistant Enterococcus spp. in animal–derived foods represents an important public health risk, as these bacteria can act as reservoirs for antibiotic resistance genes and potentially spread them to human infections. This study highlights the urgent need for improved surveillance programs to monitor the prevalence and resistance trends of Enterococcus spp. throughout the food chain. Given the potential consequences for food safety and public health, preventive measures – such as improved hygiene practices, decreased use of antimicrobials in animal husbandry, and strengthened regulatory frameworks – are essential to limit the spread of resistant bacteria. Continuous surveillance, combined with targeted intervention techniques, will be essential to reduce the risk of transmission and to ensure the microbiological safety of food of animal origin. ACKNOWLEDGMENT This research was funded by the Scientific Research Projects Commission of Sivas Cumhuriyet University (CUBAP Project Number: V-2021-110). Conflict of interest The authors declare no potential conflicts of interest. Ethics approval Ethical approval is not required for this study. BIBLIOGRAPHIC REFERENCES [1] Aamodt H, Mohn SC, Maselle S, Manji KP, Willems R, Jureen R, Langeland N, Blomberg B. Genetic relatedness and risk factor analysis of ampicillin–resistant and high–level gentamicin– resistant enterococci causing bloodstream infections in Tanzanian children. BMC Infect. Dis. [Internet]. 2015; 15:1–9. doi: https://doi.org/gb324s [2] Hollenbeck BL, Rice LB. Intrinsic and acquired resistance mechanisms in Enterococcus. Virulence [Internet]. 2012; 3(5):421–433. doi: https://doi.org/gnhw4f [3] European Food Safety Authority (EFSA), European Centre for Disease Prevention and Control (ECDC). The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2021–2022. EFSA J. [Internet]. 2024; 22(2):e08583. doi: https://doi.org/nr2j [4] Zhang Y, Du M, Chang Y, Chen LA, Zhang Q. Incidence, clinical characteristics, and outcomes of nosocomial Enterococcus spp. bloodstream infections in a tertiary–care hospital in Beijing, China: a four–year retrospective study. Antimicrob. Resist. Infect. Control. [Internet]. 2017; 6(1):1–11. doi: https://doi.org/px3b

Ampicillin resistant Enterococcus in milk and chicken samples / Şahin et al.______________________________________________________ 8 of 10 [5] Golob M, Pate M, Kušar D, Dermota U, Avberšek J, Papić B, Zdovc I. Antimicrobial resistance and virulence genes in Enterococcus faecium and Enterococcus faecalis from humans and retail red meat. Biomed. Res. Int. [Internet]. 2019; 2019:2815279. doi: https://doi.org/gm3wv5 [6] Mundy LM, Sahm DF, Gilmore M. Relationships between enterococcal virulence and antimicrobial resistance. Clin. Microbiol. Rev. [Internet]. 2000; 13(4):513–522. doi: https:// doi.org/gph9ff [7] Miller WR, Munita JM, Arias CA. Mechanisms of antibiotic resistance in enterococci. Expert. Rev. Anti. Infect. Ther. [Internet]. 2014; 12(10):1221–1236. doi: https://doi.org/f6627h [8] Willems RJ, Van Schaik W. Transition of Enterococcus faecium from commensal organism to nosocomial pathogen. Future Microbiol. [Internet]. 2009; 4(9):1125–1135. doi: https:// doi.org/cdwh4f [9] Hammerum AM, Lester CH, Heuer OE. Antimicrobial–resistant enterococci in animals and meat: a human health hazard?. Foodborne Pathog. Dis. [Internet]. 2010; 7(10):1137–1146. doi: https://doi.org/d8fpbz [10] Willems RJ, Top J, Van Santen M, Robinson DA, Coque TM, Baquero F, Bonten MJ. Global spread of vancomycin–resistant Enterococcus faecium from distinct nosocomial genetic complex. Emerg. Infect. Dis. [Internet]. 2005; 11(6):821–828. doi: https://doi.org/px3c [11] Heikens E, Singh KV, Jacques–Palaz KD, van Luit–Asbroek M, Oostdijk EA, Bonten MJ, Murray BE, Willems RJ. Contribution of the enterococcal surface protein esp to pathogenesis of Enterococcus faecium endocarditis. Microbes Infect. [Internet]. 2011; 13(14–15):1185–1190. doi: https://doi.org/ddph9k [12] Sørensen TL, Blom M, Monnet DL, Frimodt–Møller N, Poulsen RL, Espersen F. Transient intestinal carriage after ingestion of antibiotic–resistant Enterococcus faecium from chicken and pork. N. Engl. J. Med. [Internet]. 2001; 345(16):1161–1166. doi: https://doi.org/bggvbt [13] Arias CA, Murray BE. The rise of the Enterococcus: beyond vancomycin resistance. Nat. Rev. Microbiol. [Internet]. 2012; 10(4):266–278. doi: https://doi.org/f4nn43 [14] Teixeira LM, Carvalho MDGS, Facklam RR, Shewmaker PL. Enterococcus. In: Jorgensen JH, Carroll KC, Funke G, Pfaller MA, Landry ML, Richter SS, Warnock DW, editors. Manual of Clinical Microbiology. 11 th . ed. Washington, DC (USA): ASM Press; 2015. p. 403–421. [15] Guzman–Prieto AM, van Schaik W, Rogers MR, Coque TM, Baquero F, Corander J, Willems RJ. Global emergence and dissemination of enterococci as nosocomial pathogens: attack of the clones?. Front. Microbiol. [Internet]. 2016; 7:788. doi: https://doi.org/ggdgkn [16] Lebreton F, Willems RJL, Gilmore MS. Enterococcus diversity, origins in nature, and gut colonization. In: Gilmore MS, Clewell DB, Ike Y, Shankar N, editors. Enterococci: From commensals to leading causes of drug resistant infection [Internet]. Boston (USA): Massachusetts Eye and Ear Infirmary; 2014 [cite Jun. 25, 2025]. p. 1–46. Available in: https://goo.su/yIORwV [17] Pesavento G, Calonico C, Ducci B, Magnanini A, Lo Nostro A. Prevalence and antibiotic resistance of Enterococcus spp. isolated from retail cheese, ready–to–eat salads, ham, and raw meat. Food Microbiol. [Internet]. 2014; 41:1–7. doi: https://doi.org/px3f [18] Ribeiro J, Silva V, Monteiro A, Vieira–Pinto M, Igrejas G, Reis FS, Barros L, Poeta P. Antibiotic resistance among gastrointestinal bacteria in broilers: a review focused on Enterococcus spp. and Escherichia coli. Animals [Internet]. 2023; 13(8):1362. doi: https://doi.org/px3g [19] Çetinkaya F, Elal–Muş T. Yararları ve Riskleriyle Gıda Kaynaklı Enterokoklar. J. Res. Vet. Med. [Internet]. 2010 [cited Jun 14, 2025]; 29(1): 77–83. Available in: https://goo.su/pJzJp [20] Kürekci C, Önen SP, Yipel M, Aslantaş Ö, Gündoğdu A. Characterisation of phenotypic and genotypic antibiotic resistance profile of enterococci from cheeses in Turkey. Korean J. Food Sci. Anim. Resour. [Internet]. 2016; 36(3):352– 358. doi: https://doi.org/px3h [21] Yılmaz EŞ, Aslantaş Ö, Önen SP, Türkyılmaz S, Kürekci C. Prevalence, antimicrobial resistance and virulence traits in enterococci from food of animal origin in Turkey. LWT Food Sci. Technol. [Internet]. 2016; 66:20–26. doi: https://doi.org/px3j [22] Sanlibaba P, Tezel BU, Senturk E. Antimicrobial resistance of Enterococcus species isolated from chicken in Turkey. Korean J. Food Sci. Anim. Resour. [Internet]. 2018; 38(2):391–402. doi: https://doi.org/g36pjz [23] DTU National Food Institute. Protocol for PCR amplification of E. faecium and E. faecalis recommended by the EURL–AR. 3 rd version. [Internet]. Lyngby (Denmark): European Union Reference Laboratory for Antimicrobial Resistance; 2014 [cited Jan 24, 2023]. Available in: https://goo.su/SgfbJI [24] Ke D, Picard FJ, Martineau F, Ménard C, Roy PH, Ouellette M, Bergeron MG. Development of a PCR assay for rapid detection of enterococci. J. Clin. Microbiol. [Internet]. 1999; 37(11):3497–3503. doi: https://doi.org/px3k [25] Kariyama R, Mitsuhata R, Chow JW, Clewell DB, Kumon H. Simple and reliable multiplex PCR assay for surveillance isolates of vancomycin–resistant enterococci . J. Clin. Microbiol. [Internet]. 2000; 38(8):3092–3095. doi: https:// doi.org/px3m [26] Cheng S, McCleskey FK, Gress MJ, Petroziello JM, Liu R, Namdari H, Salmen A, DelVecchio VG. A PCR assay for identification of Enterococcus faecium. J. Clin. Microbiol. [Internet]. 1997; 35(5):1248–1250. doi: https://doi.org/px3n [27] Vankerckhoven V, Van Autgaerden T, Vael C, Lammens C, Chapelle S, Rossi R, Jabes D, Goossens H. Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J. Clin. Microbiol. [Internet]. 2004; 42(10):4473–4479. doi: https://doi.org/fwtgjb

_________________________________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol.XXXV 9 of 10 [28] European Committee on Antimicrobial Susceptibility Testing (EUCAST). Breakpoint tables for interpretation of MICs and zone diameters. Version 8.1. [Internet]. European Committee on Antimicrobial Susceptibility Testing; 2018. [cited Jul. 3, 2024]. Available in: https://goo.su/QKidu15 [29] Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing. 30 th . ed. Wayne (Pennsylvania, USA): Clinical and Laboratory Standards Institute; 2020. [30] Amuasi GR, Dsani E, Owusu–Nyantakyi C, Owusu FA, Mohktar Q, Nilsson P, Adu N, Hendriksen RS, Egyir B. Enterococcus species: insights into antimicrobial resistance and whole– genome features of isolates recovered from livestock and raw meat in Ghana. Front. Microbiol. [Internet]. 2023; 14:1254896. doi: https://doi.org/px3p [31] Gajewska J, Chajęcka–Wierzchowska W, Byczkowska– Rostkowska Z, Saki M. Biofilm formation capacity and presence of virulence determinants among Enterococcus species from milk and raw milk cheeses. Life [Internet]. 2023; 13(2):495. doi: https://doi.org/px3q [32] Morandi S, Silvetti T, Lopreiato V, Piccioli–Cappelli F, Trevisi E, Brasca M. Biodiversity and antibiotic resistance profile provide new evidence for a different origin of enterococci in bovine raw milk and feces. Food Microbiol. [Internet]. 2024; 120:104492. https://doi.org/px3r [33] Inhoque–Pereira R, Prichula J, Aguiar–Santestevan N, Alves–D’Azevedo P, de Souza–Motta A, Guedes–Frazzon AP. Virulence profiles in Enterococcus spp. isolated from raw buffalo’s milk in South Brazil. Res. J. Microbiol. [Internet]. 2017; 12(4):248–254. doi: https://doi.org/px3s [34] Kim HJ, Youn HY, Kang HJ, Moon JS, Jang YS, Song KY, Seo KH. Prevalence and virulence characteristics of Enterococcus faecalis and Enterococcus faecium in bovine mastitis milk compared to bovine normal raw milk in South Korea. Animals [Internet]. 2022; 12(11):1407. doi: https://doi.org/px3t [35] Buzatto–de Souza D, Inhoque–Pereira R, Endres CM, Frazzon J, Prichula J, Frazzon–Guedes AP. Resistant enterococci isolated from raw sheep’s milk and cheeses from South region of Brazil. Cienc. Rural [Internet]. 2023; 53(10):e20220288. doi: https://doi.org/px3v [36] Freitas AR, Novais C, Duarte B, Pereira AP, Coque TM, Peixe L. High rates of colonisation by ampicillin–resistant enterococci in residents of long–term care facilities in Porto, Portugal. Int. J. Antimicrob. Agents [Internet]. 2018; 51(3):503–507. doi: https://doi.org/gc7tx2 [37] Freitas AR, Tedim AP, Francia MV, Jensen LB, Novais C, Peixe L, Sánchez–Valenzuela A, Sundsfjord A, Hegstad K, Werner G, Sadowy E, Hammerum AM, Garcia–Migura L, Willems RJ, Baquero F, Coque TM. Multilevel population genetic analysis of vanA and vanB Enterococcus faecium causing nosocomial outbreaks in 27 countries (1986–2012). J. Antimicrob. Chemother. [Internet]. 2016; 71(12):3351–3366. doi: https:// doi.org/gbpcnh [38] Bortolaia V, Espinosa–Gongora C, Guardabassi L. Human health risks associated with antimicrobial–resistant enterococci and Staphylococcus aureus on poultry meat. Clin. Microbiol. Infect. [Internet]. 2016; 22(2):130–140. doi: https://doi.org/f8r93w [39] Joste V, Gydé E, Toullec L, Courboulès C, Talb Y, Riverain–Gillet E, Pangon B, Amara M. Enterococcus faecium and ampicillin susceptibility determination: overestimation of resistance with disk diffusion method using 2 micrograms of ampicillin?. J. Clin. Microbiol. [Internet]. 2019; 57(3):e01467–18. doi: https://doi.org/px3w [40] Hsieh SE, Hsu LL, Hsu WH, Chen CY, Chen HJ, Liao CT. Importance of amino acid alterations and expression of penicillin–binding protein 5 to ampicillin resistance of Enterococcus faecium in Taiwan. Int. J. Antimicrob. Agents [Internet]. 2006; 28(6):514–519. doi: https://doi.org/bs636z [41] Aslantaş Ö. Molecular and phenotypic characterization of enterococci isolated from broiler flocks in Turkey. Trop. Anim. Health Prod. [Internet]. 2019; 51(5):1073–1082. doi: https:// doi.org/px3x [42] Hunashal Y, Kumar GS, Choy MS, D’Andréa ÉD, Da Silva Santiago A, Schoenle MV, Desbonnet C, Arthur M, Rice LB, Page R, Peti W. Molecular basis of β–lactam antibiotic resistance of ESKAPE bacterium E. faecium penicillin binding protein PBP5. Nat. Commun. [Internet]. 2023; 14(1):4268. doi: https://doi.org/px3z [43] Hammad AM, Aly SS, Hassan HA, Abbas NH, Eltahan A, Khalifa E, Shimamoto T. Occurrence, phenotypic and molecular characteristics of vancomycin–resistant enterococci isolated from retail raw milk in Egypt. Foodborne Pathog. Dis. [Internet]. 2022; 19(3):192–198. doi: https://doi.org/px32 [44] Kagkli DM, Vancanneyt M, Vandamme P, Hill C, Cogan TM. Contamination of milk by enterococci and coliforms from bovine faeces. J. Appl. Microbiol. [Internet]. 2007; 103(5):1393–1405. doi: https://doi.org/d9f5j5 [45] Silvetti T, Morandi S, Brasca M. Does Enterococcus faecalis from traditional raw milk cheeses serve as a reservoir of antibiotic resistance and pathogenic traits?. Foodborne Pathog. Dis. [Internet]. 2019; 16(5):359–367. doi: https://doi.org/gmxmd3 [46] Hammad AM, Hassan HA, Shimamoto T. Prevalence, antibiotic resistance and virulence of Enterococcus spp. in Egyptian fresh raw milk cheese. Food Control [Internet]. 2015; 50:815–820. doi: https://doi.org/px33 [47] European Union (EU). Council Regulation No. 2821/98 of 17 December 1998 amending, as regards withdrawal of the authorization of certain antibiotics, Directive 70/524/EEC concerning additives in feeding stuffs. [Internet]. Official Journal of the European Communities. 1998 [cited Jan 14, 2023]. Available in: https://goo.su/Fxeg [48] Borgen K, Simonsen GS, Sundsfjord A, Wasteson Y, Olsvik Ø, Kruse H. Continuing high prevalence of vanA–type vancomycin–resistant enterococci on Norwegian poultry farms three years after avoparcin was banned. J. Appl. Microbiol. [Internet]. 2000; 89(3):478–485. doi: https://doi.org/dgh4xw

Ampicillin resistant Enterococcus in milk and chicken samples / Şahin et al.______________________________________________________ 10 of 10 [49] Bortolaia V, Mander M, Jensen LB, Olsen JE, Guardabassi L. Persistence of vancomycin resistance in multiple clones of Enterococcus faecium isolated from Danish broilers 15 years after the ban of avoparcin. Antimicrob. Agents Chemother. [Internet]. 2015; 59(5):2926–2929. doi: https://doi.org/f7fv2v [50] Onaran B, Göncüoğlu M, Ormancı FSB. Antibiotic resistance profiles of vancomycin resistant enterococci in chicken meat samples. Ank. Univ. Vet. Fak. Derg. [Internet]. 2019; 66(4):331–336. doi: https://doi.org/px34 [51] Aslantaş Ö. Investigation of faecal carriage of high–level gentamicin resistant Enterococci in dogs and cats. Isr. J. Vet. Med. [Internet]. 2022 [cited Jun 10, 2025]; 77:27–37. Available in: https://goo.su/QlqzVjW [52] Özdemir R, Tuncer Y. Detection of antibiotic resistance profiles and aminoglycoside–modifying enzyme (AME) genes in high– level aminoglycoside–resistant (HLAR) enterococci isolated from raw milk and traditional cheeses in Turkey. [Internet]. Mol. Biol. Rep. 2020; 47(3):1703–1712. doi: https://doi.org/px35 [53] Nasiri M, Hanifian S. Enterococcus faecalis and Enterococcus faecium in pasteurized milk: Prevalence, genotyping, and characterization of virulence traits. LWT–Food Sci. Technol. [Internet]. 2022; 153:112452. doi: https://doi.org/px36 [54] Yalçın M, Tuncer Y. Determination of the antibiotic resistance profiles of high–level aminoglycoside–resistant enterococci isolated from broiler meat. Gıda. [Internet]. 2021; 46(4):803– 816. doi: https://doi.org/px37 [55] Martinez–Laorden A, Arraiz–Fernandez C, Gonzalez–Fandos E. Identification and characterisation of antimicrobial resistance of Enterococcus spp. isolated from pork and poultry meat. Int. J. Food Sci. [Internet]. 2023; 58(8):4455–4463. doi: https:// doi.org/px38 [56] Arias CA, Contreras GA, Murray BE. Management of multidrug– resistant enterococcal infections. Clin. Microbiol. Infect. [Internet]. 2010; 16(6):555–562. https://doi.org/dp836z [57] Boccella M, Santella B, Pagliano P, De Filippis A, Casolaro V, Galdiero M, Borrelli A, Capunzo M, Boccia G, Franci G. Prevalence and antimicrobial resistance of Enterococcus species: A retrospective cohort study in Italy. Antibiotics [Internet]. 2021; 10(12):1552. doi: https://doi.org/gppfvg [58] de Jong A, Simjee S, Garch FE, Moyaert H, Rose M, Youala M, Dry M. Antimicrobial susceptibility of enterococci recovered from healthy cattle, pigs, and chickens in nine EU countries (EASSA Study) to critically important antibiotics. Vet. Microbiol. [Internet]. 2018; 216:168–175. doi: https://doi.org/gdbb74 [59] Jamet E, Akary E, Poisson MA, Chamba JF, Bertrand X, Serror P. Prevalence and characterization of antibiotic–resistant Enterococcus faecalis in French cheeses. Food Microbiol. [Internet]. 2012; 31(2):191–198. doi: https://doi.org/p8zb [60] Gołaś–Prądzyńska M, Rola JG. Occurrence and antimicrobial resistance of enterococci isolated from goat’s milk. J. Vet. Res. [Internet]. 2021; 65(4):449–455. doi: https://doi.org/gq8xkc [61] World Health Organization (WHO). Critically important antimicrobials for human medicine 6 th . revision. WHO Advisory Group on Integrated Surveillance of Antimicrobial Resistance (AGISAR) [Internet]. Geneva (Switzerland): World Health Organization; 2019 [cited Jun 15, 2024]. Available in: https:// goo.su/kYTnb [62] Biswas PP, Dey S, Adhikari L, Sen A. Virulence markers of vancomycin–resistant enterococci isolated from infected and colonized patients. J. Glob. Infect. Dis. [Internet]. 2014; 6(4):157–163. doi: https://doi.org/px4b [63] Paschoalini BR, Nuñez KVM, Maffei JT, Langoni H, Guimarães FF, Gebara C, Freitas NE, Dos Santos MV, Fidelis CE, Kappes R, Gonçalves MC, Silva NCC. The emergence of antimicrobial resistance and virulence characteristics in Enterococcus species isolated from bovine milk. Antibiotics [Internet]. 2023; 12(8):1243. doi: https://doi.org/px4c [64] Eaton TJ, Gasson MJ. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl. Environ. Microbiol. [Internet]. 2001; 67(4):1628–1635. doi: https://doi.org/dsxdgz [65] Heikens E, van Schaik W, Leavis HL, Bonten MJ, Willems RJ. Identification of a novel genomic island specific to hospital– acquired clonal complex 17 Enterococcus faecium isolates. Appl. Environ. Microbiol. [Internet]. 2008; 74(22):7094– 7097. doi: https://doi.org/b27g5b [66] Khan H, Flint S, Yu PL. Enterocins in food preservation. Int. J. Food Microbiol. [Internet]. 2010; 141(1–2):1–10. doi: https:// doi.org/dqkxc7