Received: 28/02/2025 Accepted: 03/05/2025 Published: 13/05/2025 1 of 8 https://doi.org/10.52973/rcfcv-e35645 Revista Cientíﬁca, FCV-LUZ / Vol. XXXV ABSTRACT Freshwater stingrays of the Potamotrygonidae family are highly valued in the international market as ornamental ﬁsh, leading to growing demand and economic signiﬁcance. In Colombia, despite legal regulations aimed at protecting these animals and their habitats, the effectiveness of these norms is not always assured. This is partly due to export regulations focusing on morphological criteria for species identiﬁcation, which may result in inaccuracies, prompting the search for a more precise method based on genetic aspects such as DNA barcoding. This study aimed to assess the potential of the Cytb and COI genes as molecular markers for identifying a species within the Potamotrygonidae family in Colombia using the barcoding technique. DNA was extracted from blood samples of various stingray species from the Puerto Inírida basin, using PCR to amplify speciﬁc regions of the COI and Cytb genes, which were then sequenced using the Sanger method. The sequences were read in BioEdit, manually cleaned, analyzed in the BLAST program, and aligned in MEGA, where a neighbor–joining tree was constructed using the Kimura 2– parameter model (K2P). Results indicated no genetic identity between the obtained sequences and the unidentiﬁed stingray sequence compared to those in GenBank, nor with other analyzed species, both for COI and Cytb. Phylogenetic analysis showed that the conﬁscated individual exhibited genetic proximity to Potamotrygon motoro. Additionally, a close genetic relationship between Potamotrygon orbignyi and Potamotrygon schroederi was identiﬁed. In conclusion, the phylogenetic method suggests that the seized stingray likely belongs to Potamotrygon motoro. Furthermore, the barcoding method alone is not ideal for identifying species of the Potamotrygonidae family Key words: DNA–Barcoding; Potamotrygonidae; forensic sciences RESUMEN Las rayas de agua dulce de la familia Potamotrygonidae son muy valoradas en el mercado internacional como peces ornamentales, lo que lleva a una creciente demanda y signiﬁcancia económica. En Colombia, a pesar de las regulaciones legales para proteger a estos animales y sus hábitats, la efectividad de estas normas no siempre está asegurada. Esto se debe en parte a que las regulaciones de exportación se centran en criterios morfológicos para la identificación de especies, lo que puede resultar en inexactitudes. Este estudio evaluó el potencial de los genes Cytb y COI como marcadores moleculares para identiﬁcar una especie dentro de la familia Potamotrygonidae en Colombia usando la técnica de código de barras. Se extrajo ADN de muestras de sangre de varias especies de rayas del río Puerto Inírida, utilizando PCR para ampliﬁcar regiones especíﬁcas de los genes COI y Cytb, que luego se secuenciaron con el método Sanger. Las secuencias se leyeron en BioEdit, se limpiaron manualmente, se analizaron en BLAST y se alinearon en MEGA, donde se construyó un árbol neighbor–joining usando el modelo de 2 parámetros de Kimura. Los resultados indicaron que no hubo identidad genética entre las secuencias obtenidas y la secuencia de la raya no identiﬁcada en comparación con las depositadas en GenBank, ni con otras especies analizadas. El análisis ﬁlogenético mostró que el individuo conﬁscado exhibía proximidad genética a Potamotrygon motoro. Además, se identificó una estrecha relación genética entre Potamotrygon orbignyi y Potamotrygon schroederi. En conclusión, el método ﬁlogenético sugiere que la raya incautada probablemente pertenece a Potamotrygon motoro. Además, se concluye que el método de código de barras por sí solo no es ideal para identiﬁcar especies de la familia Potamotrygonidae. Palabras clave: Código de barras de ADN; Potamotrygonidae; veterinaria forense Forensic Application of Cytb and COI Genes for Freshwater stingray Identiﬁcation: A Seizure Case in Bogotá, Colombia Aplicación forense de los genes Cytb y COI para la identiﬁcación de rayas de agua dulce: Un caso de incautación en Bogotá, Colombia Lisbeth Gelvez¹ , Ana Cuellar¹ , María Gómez¹ , Jorge Oliveros 2 , Paola Alméciga–Diaz³ , Myreya Pinedo–Castro⁴ , John Infante–González 5 * ¹Fundación Universitaria Agraria de Colombia, Semillero de Investigación en Ciencias Animales y Seguridad Alimentaria. Bogotá, Colombia. ²Universidad Militar Nueva Granada, Bogotá, Colombia. ³Universidade Federal Do Río Grande. Río Grande, Brasil. ⁴Pontiﬁcia Universidad Javeriana, Facultad de Ciencias, Departamento de Biología. Bogotá, Colombia. ⁵Fundación Universitaria Agraria de Colombia, Programa de Medicina Veterinaria. Bogotá, Colombia. *Corresponding author: infante.john@uniagraria.edu.co

Forensic DNA identiﬁcation of freshwater stingrays / Gelvez et al.____________________________________________________________________ 2 of 8 INTRODUCTION The Potamotrygonidae family, commonly known as river stingrays or freshwater stingrays, comprises a group of cartilaginous ﬁsh found exclusively in South America [1]. These species are distributed in rivers throughout the region, with a notable concentration in the Amazon River basin and its extensive network of tributaries. Among these water bodies are not only the Amazon River itself but also the Orinoco River, Paraná River, Paraguay River, and other smaller river systems that traverse the vast Amazon region and the Southern Cone of South America [1]. Species of Potamotrygon reported for Colombia include Potamotrygon constellata, Potamotrygon magdalenae, Potamotrygon motoro, Potamotrygon orbignyi, Potamotrygon schroederi, Potamotrygon scobina, and Potamotrygon yepezi, with the genus Potamotrygon being the most diverse with 36 species [2, 3, 4, 5, 6]. These species play an important ecological role in regulating ﬁsh, crustacean, and insect populations in their aquatic habitats, thus maintaining the balance of the ecosystems where they thrive [7]. In Latin America, the export of these species is a frequent activity, driven by the growing demand in sectors such as aquaristics, gastronomic, artisanal manufacturing (e.g., drums and sandpapers), and alternative medicine. On the other hand, in the commercial sphere, the funds generated through the capture of these stingrays play a signiﬁcant role in local communities living near rivers, providing a supplementary income of value during several months of the year [8]. To preserve and protect these animal populations, some regulations and laws have been implemented aiming to conserve their habitats, considering that several of them are categorized as near threatened (NT) and vulnerable (VU) [9]. Despite the efforts made by the Colombian government, effective monitoring of stingray populations is not always ensured due to limited information on their handling, taxonomy, human impact (overﬁshing and bycatch), and the sustainable management of ornamental ﬁshery resources [10, 11]. As an example, ﬁshermen are still allowed to operate under a regime of open access, neglecting the importance of educating about the conservation status of the species and the beneﬁts of sustainable ﬁshing [12]. The Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES), has played a crucial role in classifying species of the Potamotrygon genus subject to stricter regulation regarding their international trade [8]. These species include P. constellata, P. magdalenae, P. schroederi, P. motoro, P. orbignyi, P. scobina, and P. yepezi, all included in Appendix III. In turn, the National Action Plan (NAP) established by the Ministry of Environment and Sustainable Development for the Colombian Amazon assigns a very high priority level to obtaining information about the species P. motoro and P. orbignyi [12]. Restricting the export of species is crucial to mitigate the negative impact on aquaculture populations and their ecosystems. However, accurate species identiﬁcation during individual capture is crucial. This underscores the importance of employing effective and understandable methods for ﬁshermen, who often distinguish species primarily through morphological aspects, such as the number and arrangement of ﬁns, individual size, and color pattern [13]. However, relying solely on these characteristics for identiﬁcation can lead to signiﬁcant errors, prompting the current consideration of molecular factors. To prevent of illegal exportation, it is necessary for authorities to implement a more precise identiﬁcation method that allows species determination genetically, such as mitochondrial DNA barcode analysis, a method that has been increasingly adopted by the scientiﬁc community for this purpose, as it enables species and subspecies identiﬁcation [14]. In the ﬁeld of forensic genetics, barcoding is employed to analyze DNA polymorphisms. This method has been successfully applied in biodiversity conservation, enabling the identiﬁcation of species at risk or present in protected areas. This information signiﬁcantly contributes to decision–making for species preservation. Additionally, barcoding has applications in the trade of biological products, such as species recognition in the food market, control of invasive species, or detection of species in traditional medicine products [14]. Furthermore, it has been used in species characterization in ecological and evolutionary studies, enabling the investigation of genetic diversity patterns, phylogenetic relationships, and species migration. Additionally, it has been employed in the identiﬁcation of a wide range of animal species, including insects such as members of the genus Spodoptera (Lepidoptera), as well as Diptera, Psychodidae, Phlebotominae, and Hemiptera. It has also been applied to birds and mammals in forensic investigations. [15, 16, 17, 18, 19]. The most commonly used molecular markers in this type of study are mitochondrial DNA (mtDNA) markers, favored for their high polymorphism, lack of recombination, efﬁcient isolation from minimal biological tissue, and resistance to degradation. As mtDNA is maternally inherited, it is particularly useful for tracing evolutionary relationships and providing unique population–level data [4, 20]. The mitochondrial gene Cytochrome c Oxidase 1 (COI) is widely employed in barcoding due to its conserved regions, which allow for universal primer design across diverse organisms, and its effectiveness in species discrimination [20]. Similarly, the cytochrome b gene (Cytb) is valuable for differentiating closely related species and providing robust phylogenetic insights [17]. The aim of this study was to assess the potential of the Cytb and COI genes as molecular markers for species identiﬁcation within the Potamotrygonidae family in Colombia through the barcoding technique. MATERIALS AND METHODS Case history Fishermen from Guainía, Colombia, involved in artisanal ornamental ﬁshing, sold a batch of freshwater stingrays (Potamotrygon spp.) to a Bogotá–based export company. After quarantine protocols by ICA, stingrays were selected for export to Vietnam, complying with CITES permits issued by AUNAP, ICA, and SDA. During a routine inspection at El Dorado International Airport, a stingray specimen exhibited atypical morphological traits, lacking the characteristic ocelli of P. motoro (brown–olive to dark gray with yellow–orange spots) [9] (FIG. 1). Due to concerns of illegal trafﬁcking, its export was halted, and genetic analysis was initiated to conﬁrm its species. Blood samples were extracted from six specimens belonging to the species P. motoro (n=2), P. orbignyi (n=2), and P. schroederi (n=1), as well as from one taxonomically unidentiﬁed individual (n=1), which was conﬁscated at El Dorado International Airport, Bogotá, Colombia. These individuals were acquired from the same ornamental ﬁsh establishment in Bogotá, Colombia, where the stingray was previously seized. This center reported that the stingrays originated from the Puerto Inírida basin. This information

_________________________________________________________________________________________________Revista Cientiﬁca, FCV-LUZ / Vol.XXXV 3 of 8 is relevant for achieving a more precise approach if conclusive results are not obtained through the BLAST (Basic Local Alignment Search Tool) search in GenBank. Blood samples were obtained by immersing the stingrays in a solution of 1 liter of water and Eugenol at a concentration of 40 mg·L -1 for 5 min to sedate them. Subsequently, a 3 to 5 mL blood sample was extracted from the caudal vein located under the tail. These samples were promptly transferred to a Vacutainer tube containing Ethylenediaminetetraacetic acid (EDTA) for preservation and storage. Genomic DNA extraction was performed using the Monarch® Genomic DNA Puriﬁcation Kit (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s instructions. The collected genetic extract was quantified using a DeNovix® DS–11 FX+ nanodrop (Denovix Inc. Wilmington, USA). In preparation for Polymerase Chain Reaction (PCR), the DNA extracts from each sample were diluted to a concentration of 40 ng·μL -1 . Subsequently, a mixture of the reagents to be used was prepared in 1.5 mL conical tubes, with each tube containing 4.5 μL magnesium chloride (MgCl2) (2.25 mM), 4 μL dNTPs (0.8 mM), 0.62 μL of each primer (1.25 mM), 5 μL buffer, 1 μL Taq (1U), 33.2 μL water, and 1 μL of DNA, resulting in a total volume of 50 μL per tube. The processing of the samples, extraction, and ampliﬁcation were carried out in the Laboratory of Molecular Population Genetics and Evolutionary Biology at the Pontiﬁcia Universidad Javeriana. The primers FPmagCOI531 (5'–GCAATCTCTCAATACCAAACACCAC–3') and RPmagCOI1432 (5'–CGTTTTGATGCAAATGCTTCTCAGAG–3') [21], were used for the COI gene, while the primers FPmagCYTB182 (5'–CATCAGCCTTCTCCTCMATCGCAC–3') and RPmag932 (5'– CGGAAGGTGAGGCTTCGTTGTTTGG–3') [21] were used for the Cytb gene. The ampliﬁcation protocol was performed using a T100® Thermal Cycler from BioRad (Bio–Rad Laboratories, California, USA) under the following conditions: an initial denaturation at 94°C for 5 min, followed by 25 cycles comprising denaturation at 94°C for 30 seconds (s), an annealing phase at 60.1°C (COI gene) or 58°C (Cytb gene) for 30 s, an extension at 72°C for 30 s, and a ﬁnal extension at 72°C for 7 min. The resulting samples were stored at 4°C in a refrigerator (Supernordico, Colombia). Subsequently, the amplicons were veriﬁed through agarose gel electrophoresis (Thermo EC 330, USA) at 0.8% using the Quick–Load® Purple 1 kb Plus DNA Ladder molecular weight marker. Once ampliﬁcation was conﬁrmed, the resulting DNA was sent to the GenCore laboratory at University of the Andes in Bogotá, Colombia. The puriﬁed products after PCR ampliﬁcation were automatically sequenced in both directions (5' to 3' and 3' to 5') using the tagDye Deoxy Terminator Cycle–sequencing method on a 3730XL sequencer (Applied Biosystems, USA). The generated electropherograms were analyzed using BioEdit® v.7.7.1 and PeakTrace® v.6.6 software to obtain the DNA sequences. These sequences were aligned using MEGA® v.11 software. Intra–and interspeciﬁc genetic distances were calculated using the neighbor–joining (NJ) evolutionary method and the Kimura 2-parameter (K2P) substitution model [22]. The resulting dendrogram was obtained in MEGA® v.6.0 with 1000 bootstrap replicates [23]. All analyzed sequences were submitted to the National Center for Biotechnology Information (NCBI) and assigned unique accession numbers: PP873634 to PP873638 for COI and PQ015594 to PQ015598 for Cytb. The GenBank BLAST tool was used to identify species with the highest similarity and alignment length percentage. For phylogenetic analyses involving other Colombian stingray species, including those obtained in this study, the following GenBank sequences were considered: MW482070.1 (P. schroederi – Cytb), MW482065.1 (P. orbignyi – Cytb), MW481862 (P. magdalenae – Cytb), MW481840.1 (P. hystrix – Cytb), MW482068.1 (P. motoro – Cytb), MW482173.1 (P. magdalenae – COI) [24], NC_023116 (P. motoro – complete genome) [25], EF532673.1 (P. schroederi – COI), EF532666.1 (P. orbignyi – COI) [26], and MK520996.1 (P. hystrix – COI) [2]. Finally, the two analyzed genes were concatenated to obtain more reliable information, considering the sequences obtained from the Puerto Inírida individuals. RESULTS AND DISCUSSION Ampliﬁcation for the COI and Cytb genes for the Potamotrygon genus was successful using primers originally designed for the species P. magdalenae [21]. Manual ﬁltering of the sequences yielding the following results regarding sequence lengths for the COI gene, ranging from 612 bp for P. schroederi to 689 bp for one of the individuals of the unknown species. For the Cytb gene, sequence sizes ranged from 620 bp for P. schroederi to 728 bp for one of the two individuals of the species P. orbignyi. From these, 34 variable positions were found in the COI gene sequence (FIG. 2) and 50 in the Cytb gene sequence (FIG. 3). In the former, a similarity was observed between P. orbignyi and P. schroederi, as well as between P. motoro and the unknown stingray species. In both cases, the sequences exhibited signiﬁcant similarity due to a higher number of shared nitrogenous bases among the species. However, for the Cytb gene, 3 positions (2 transitions and 1 transversion) were found to have changes between the sequences of the species P. orbignyi and P. schroederi. Additionally, the sequence of the unknown species stingray showed variation in 5 transversions compared to the sequences of P. motoro. Finally, it was identiﬁed that the sequences belonging to P. orbignyi showed 2 transitions and 1 transversion compared to the other species, found from position 594 to 596, suggesting that this change may be signiﬁcant in differentiating this species from the others studied in this family. FIGURE 1. Conﬁscated individual at El Dorado Airport, Bogotá, Colombia

Forensic DNA identiﬁcation of freshwater stingrays / Gelvez et al.____________________________________________________________________ 4 of 8 BLAST analysis for the COI Gene According to the results obtained using the BLAST tool to analyze the COI gene sequences in the GenBank database, there is signiﬁcant genetic similarity between the unidentiﬁed stingray and the species P. falkneri (98.55%) and P. motoro (98.40%), based on the percentage of identity. Although P. falkneri shows a higher identity percentage, there are no records of its presence in the Puerto Inírida basin, the location where the stingrays were obtained [8]. Therefore, it is inferred that the unidentiﬁed stingray is more closely related to P. motoro. For the other individuals analyzed with the BLAST tool in this study, where the species were identiﬁed, it was found that the sample from the P. schroederi stingray shows the highest genetic similarity, with a 99.76% identity percentage with P. schroederi and 94.9% with P. magdalenae, with coverages of 68% and 100%, respectively. Regarding one of the samples of the P. orbignyi species, identity percentages of 94.29% with P. magdalenae, 91.90% with P. motoro, and 91.75% with P. orbignyi were identiﬁed, each with a coverage of 100%. For the second sample of P. orbignyi analyzed, a similarity was observed with the same species identiﬁed in the previous sample, with identity percentages of 94.45%, 92.21%, and 92.06%, and coverages of 99%, 99%, and 98%, respectively. Concerning the two samples analyzed for the species P. motoro, both align with the species’ identiﬁcation according to the BLAST results from GenBank. However, it is noteworthy that BLAST reveals a signiﬁcant genetic similarity to P. falkneri. In one of these samples, an identity percentage of 98.20% and a coverage of 100% were recorded for both P. motoro and P. falkneri. In the second sample, an identity percentage of 98.52% with a coverage of 99% was observed for P. falkneri, while for P. motoro, it showed an identity percentage of 98.05% with a coverage of 100%. The high genetic similarity between P. falkneri and P. motoro, reported by Cruz et al. [2], includes documented cases of hybridization, attributed to ecological proximity, genetic relationship, and the same number of chromosomes. Additionally, Sanches et al. [24] indicate hybridization events among other species of Potamotrygon (P. motoro, P. orbignyi, P. scobina, and P. leopoldi) in the Xingu River basin, Brazil. Therefore, further research is suggested to determine whether P. falkneri constitutes an independent species or, conversely, a subspecies of P. motoro. BLAST analysis for the Cytb Gene Contradictory results were observed in the genetic analysis using BLAST to determine the species of the stingray under investigation. For the Cytb gene, the ﬁrst result indicated P. orbignyi with an identity percentage of 98.78%, while the second result was P. motoro with 97.56%. In contrast, for the COI gene, the primary result was P. falkneri, followed by P. motoro. Although both analyses converge on identifying P. motoro, the discrepancy between the top species indicated for each gene complicates the accurate determination of the stingray species. Upon analyzing the other individuals, a signiﬁcant match was observed in the genetic sequence of the P. schroederi individual with a GenBank sequence corresponding to P. schroederi and another to P. orbignyi, sharing a coverage of 79% and an identity percentage of 100% with both. However, identity percentages of 93.23, 93.06, and 92.58% were obtained with the species P. magdalenae, P. hystrix, and P. yepezi, respectively, with a coverage of 100% for these three. Although a high identity percentage was found, the low coverage makes the data inconclusive for this sample. Similarly, the high identity percentage with various species within the genus complicates the correct classiﬁcation of the animal into one of these. Regarding the two analyzed individuals of P. orbignyi, a match is evident with the GenBank sequences corresponding to P. orbignyi, revealing an identity percentage of 99.66% with a coverage of 81% for the ﬁrst specimen and an identity percentage of 100% with a coverage of 80% for the second. These results represent conclusive ﬁndings, indicating a high match of the samples with the GenBank sequences for this species. FIGURE 2. Variable positions (bp) in the COI gene sequences obtained from individuals of the genus Potamotrygon and the unknown stingray species (generated using MEGA software) FIGURE 3. Variable positions (bp) in the Cytb gene sequences obtained from individuals of the genus Potamotrygon and the unknown stingray species (generated using MEGA software)

_________________________________________________________________________________________________Revista Cientiﬁca, FCV-LUZ / Vol.XXXV 5 of 8 Exploring barcoding in Colombian freshwater stingrays The ﬁndings of this study align with the observations of Toffoli et al. [25], where the application of barcoding did not yield conclusive results. During the BLAST analysis, the identity percentages of the samples matched various species of Potamotrygon, suggesting that this genus may maintain a high degree of genetic homogeneity, which complicates the precise identiﬁcation of its species through barcoding. Additionally, it is noted that mtDNA sequences are not effective for accurately establishing species boundaries, especially in recently evolved species. Contrary to these conclusions, Cerutti et al. [26] argue that this method is highly useful for stingrays and sharks. Similarly, Pereira et al. [27] support this stance by demonstrating the efﬁcacy of barcoding in identifying recently evolved megadiverse fauna, successfully discriminating 99.2% of the species analyzed in their study. In line with the issues identiﬁed by Toffoli et al. [25], Li et al. [28] propose barcoding as a strategy to detect potential errors in GenBank data, speciﬁcally using the Cytb gene. On the other hand, an internationally established species– speciﬁc barcode for ﬁsh, based on the mitochondrial COI gene, has been developed. This barcode consists of DNA fragments ranging from 600 to 650 base pairs. However, it has been suggested that only 100 base pairs in a DNA sequence are sufﬁcient to adequately identify and distinguish species [29, 30]. In the present study, the obtained sequences ranged from 500 bp to 900 bp, theoretically providing an adequate size for species identiﬁcation. However, the desired results were not achieved, as not all samples matched their respective species during the BLAST analysis. In some cases, they matched with more than one species depending on the identity percentage. This suggests that sequences with a greater number of base pairs or the study of additional genes may be necessary to effectively identify the known or unknown species of the genus Potamotrygon found in the Inírida area. Phylogenetic analyses for the COI gene Phylogenetic analysis of COI gene sequences strongly supports a monophyletic clade containing P. orbignyi and P. schroederi (bootstrap=100), conﬁrming their close evolutionary relationship. The topology further resolves P. motoro and an unidentiﬁed stingray as sister taxa (Fig. 4). Comparative analysis revealed greater phylogenetic utility of Cytb over COI, with Cytb exhibiting higher nucleotide variability despite conservative substitution patterns in both markers. Phylogenetic analyses using sequences downloaded from GenBank for the COI gene Phylogenetic analysis of COI gene sequences demonstrated clustering of our P. motoro specimens with GenBank references (bootstrap=51), while P. schroederi formed an intermediate clade with P. orbignyi (bootstrap=47). Notably, P. orbignyi references exhibited stronger afﬁnity to P. motoro (bootstrap=59), suggesting potential biogeographic or mutational influences. In contrast, P. magdalenae and P. hystrix occupied phylogenetically distinct positions (Fig. 5), consistent with their allopatric distribution. Phylogenetic analysis of the Cytb gene Phylogenetic analyses of the Cytb gene resolve P. orbignyi and P. schroederi as sister taxa (Fig. 6), a relationship corroborated by COI gene topology. Notably, an unidentiﬁed stingray specimen clusters with P. motoro in both gene trees, reinforcing the consistency of these phylogenetic associations. FIGURE 4. Resulting neighbor–joining tree for the analysis of COI gene sequences from individuals originating from Puerto Inírida, using the Kimura 2-parameter (K2P) model FIGURE 6. Resulting neighbor–joining tree for the analysis of the Cytb gene with individuals from Puerto Inírida, using the K2P model FIGURE 5. Phylogenetic relationship between GenBank sequences and individuals from the present study originating from Puerto Inírida for the COI gene, based on a neighbor–joining tree using the K2P model

Forensic DNA identiﬁcation of freshwater stingrays / Gelvez et al.____________________________________________________________________ 6 of 8 Phylogenetic analyses using sequences obtained from GenBank for the Cytb gene Based on the analysis of the results obtained through phylogenetic trees for the Cytb gene, the association of P. schroederi and P. orbignyi in the same clade (BP=100) was observed. Additionally, the association among individuals of P. motoro in a separate clade (BP=71) was highlighted (FIG. 7). However, unlike the COI gene tree, a closer relationship of P. hystrix (BP=54) to the sequences of P. motoro and the unknown stingray from Puerto Inírida (BP=100) was evidenced, while P. magdalenae was placed in a separate clade between the two main clades. This ﬁnding is of particular importance, as it reveals an association between the unknown species and P. motoro in the phylogenetic tree of the Cytb gene, consistent with previous analyses. In this study, it was observed that the sequences in the COI gene are more conserved, which may hinder species classiﬁcation. In contrast, the Cytb gene showed greater afﬁnity for this task by presenting a higher number of variable positions among species, highlighting its utility for more accurate species classiﬁcation and analysis methods (BLAST and phylogeny). Additionally, a marked genetic closeness was found among the sequences of the genus Potamotrygon for the two genes studied. Therefore, the use of a greater number of genes and sequences from other species is suggested to improve classiﬁcation at this level, supporting the results presented by Toffoli et al. [25]. ecosystems during a Miocene invasion (which began 23.03 million years ago and ended 5.332 million years ago). The diversiﬁcation of the Potamotrygonidae family is attributed to an endemic evolutionary radiation in South America, linked to geological events that formed the Amazon and Orinoco basins. This research justiﬁes the low diversiﬁcation of the family due to the endemic evolutionary radiation, which established physical barriers and intraspeciﬁc variation (phenotypic differences within the same species). It is important to consider that phylogenetic relationships are influenced not only by time but also by biogeography and the distribution patterns of freshwater stingray groups [32]. As a result, the phylogenetic tree not only sheds light on the evolutionary history of species with a common ancestor but also reveals the temporal progression of their evolutionary trajectories [33]. This phenomenon is clearly manifested in the associations observed in the trees, where it is possible to identify the grouping of more than one species in the same clade. Phylogenetic analysis for concatenated COI and Cytb genes The concatenation of the COI and Cytb genes conﬁrms the observations from the individual gene trees, supporting the relationship between the unknown stingray species and P. motoro, suggesting the possibility that it belongs to this species. Furthermore, the tree shows that P. orbignyi and P. schroederi cluster in the same clade, indicating a close evolutionary relationship between these species (FIG. 8). Regarding the phylogeny of Potamotrygon, Lovejoy [31] suggests that neotropical freshwater stingrays share a common ancestor that invaded these Regarding the coloration of the conﬁscated species Regarding the unidentiﬁed stingray, the possibility of pathological processes affecting the phenotype of the studied individual is considered, as it presents depigmented areas of skin (FIG. 1). One potential pathology is infection by Flexibacter columnaris, caused by a group of bacteria belonging to the Myxobacteria, which manifests as an opportunistic disease, particularly under stress or poor water quality conditions. These bacteria are common in aquatic environments, colonizing the gills and skin of ﬁsh. Lesions often appear as small white spots on the caudal ﬁn, progressing towards the head. The caudal and anal ﬁns can be severely affected, showing erosions. In more advanced stages of the disease, the ﬁsh’s skin may present numerous white or grayish ulcers, potentially compromising the gills [34]. Additionally, this ﬁnding is consistent with a possible infection by Mycobacterium, which manifests on the ﬁsh’s surface with clinical signs including emaciation, inflamed skin with loss of color, vertebral deformation, open lesions, and ulcers [34]. Similarly, infection by Aeromonas causes hemorrhagic ulcerative formations on the skin, typically around the periocular area, edema FIGURE 7. Phylogenetic relationship between GenBank sequences and the individuals analyzed in the present study for the Cytb gene, based on a neighbor– joining tree using the K2P model FIGURE 8. Resulting neighbor–joining tree from the concatenation of the COI and Cytb genes for individuals from Puerto Inírida, using the K2P model

_________________________________________________________________________________________________Revista Cientiﬁca, FCV-LUZ / Vol.XXXV 7 of 8 in different parts of the body, desquamation, and in some cases, depigmentation [35]. Nutrient deﬁciencies could also be related to the appearance of skin spots. For instance, linoleic acid and linolenic acid cannot be synthesized by the ﬁsh, and their deﬁciency can lead to depigmentation, ﬁn erosion, and fatty inﬁltration of the liver [34]. Another important consideration is that the coloration of ﬁsh skin results from the interaction of various types of chromatophores. A possible genetic pathology affecting the individual could be leucism, attributed to the mutation of recessive genes during embryonic development, inhibiting the migration of melanoblasts (pigment– producing cells), resulting in partial or total absence of pigmentation in the skin while maintaining normal retinal pigmentation. However, the etiology of these chromatic variations can be multifactorial, involving non–pathological genetic mutations, population isolation, environmental stress, and heavy metal exposure [36]. CONCLUSION The results obtained in this study suggest limitations in the effectiveness of the Cytb and COI genes as molecular markers for identifying species within the Potamotrygonidae family. Based on the analysis conducted using the BLAST tool from GenBank and the phylogenetic relationships established through the neighbor– joining methodology, it is suggested that the stingray in question likely belongs to the species Potamotrygon motoro, indicating that its trade is legal and does not involve illegal trafﬁcking of wild species. Furthermore, the analysis of the Cytb gene, due to its greater genetic variability, demonstrates a stronger association and suitability for phylogenetic identiﬁcation compared to the COI gene. It is also emphasized that combining both genes yields more reliable results. However, it is important to note that barcoding alone is not the ideal technique for identifying species within the Potamotrygon genus; integration with other disciplines, such as ecology and biogeography, along with knowledge of morphological and behavioral characteristics, is necessary. Conflict of interest The authors declare that they have no conflict of interest to disclose. BIBLIOGRAPHIC REFERENCES [1] Silva–Loboda T, Rodrigues–de Carvalho M. Systematic revision of the Potamotrygon motoro (Müller & Henle, 1841) species complex in the Paraná–Paraguay basin, with description of two new ocellated species (Chondrichthyes: Myliobatiformes: Potamotrygonidae). Neotropical Ichthyol. [Internet]. 2013; 11(4):693-737. doi: https://doi.org/f5qwmw [2] Paes–da Cruz V, Oliveira–Nobile ML, Gomes–Paim F, de Lima– Adachi AMC, da Silva–Ribeiro G, Ferreira DC, Pansonato–Alves JC, Charvet P, Oliveira C, Foresti F. Cytogenetic and molecular characteristics of Potamotrygon motoro and Potamotrygon sp. (Chondrichthyes, Myliobatiformes, Potamotrygonidae) from the Amazon basin: Implications for the taxonomy of the genus. Genet. Mol Biol. [Internet]. 2021; 44(2):e20200083. doi: https://doi.org/n7wm [3] Garcia DA, Lasso CA, Morales M, Caballero SJ. Molecular systematics of the freshwater stingrays (myliobatiformes: potamotrygonidae) of the Amazon, Orinoco, Magdalena, Esequibo, Caribbean, and Maracaibo basins (Colombia – Venezuela): evidence from three mitochondrial genes. Mitochondrial DNA Part A. [Internet]. 2016; 27(6):4479-4491. doi: https://doi.org/n7wn [4] Nachtigall PG, Loboda TS, Pinhal D. Signatures of positive selection in the mitochondrial genome of neotropical freshwater stingrays provide clues about the transition from saltwater to freshwater environment. Mol. Genet. Genomics [Internet]. 2023; 298(1):229-241. doi: https://doi.org/n7wp [5] Ory D, Cuenot Y, Vigouroux R, Covain R, Brosse S, Murienne J. Complete mitochondrial genome of the river stingray Potamotrygon orbignyi (Myliobatiformes: Potamotrygonidae). Mitochondrial DNA Part B. [Internet]. 2019; 4(2):3153-3154. doi: https://doi.org/n7wq [6] Torres Y, Faria VV, Charvet P. Current status and future perspectives of Neotropical freshwater stingrays (Potamotrygoninae, Myliobatiformes) genetics. Environ. Biol. Fishes [Internet]. 2022; 105(8):1111-1127. doi: https://doi. org/f24mbz [7] Flowers KI, Heithaus MR, Papastamatiou YP. Buried in the sand: Uncovering the ecological roles and importance of rays. Fish Fish. [Internet]. 2021; 22(1):105-127. doi: https://doi. org/gkzkb8 [8] Lasso C, Rosa RS, Duarte PS, Betancourt MM, Cordoba EA. IX. Rayas de agua dulce (Potamotrygonidae) de Suramérica. Parte I. Colombia, Venezuela, Ecuador, Perú, Brasil, Guyana, Surinam y Guayana Francesa: diversidad, bioecología, uso y conservación. Instituto de Investigación de los Recursos Biológicos Alexander von Humboldt (IAvH). Bogotá, D.C., Colombia. Serie Editorial Recursos Hidrobiológicos y Pesqueros Continentales de Colombia; 2013. [9] Mojica JI, Usma JS, Álvarez–León R, Lasso CA. Libro rojo de peces dulce acuícolas de Colombia 2012 [Internet]. 2012 [cited 13 Feb 2025]; 319 p. Available in: https://goo.su/graTqkO [10] Márquez–Velásquez V, Rosa RS, Galindo E, Navia AF. Feeding habits and ecological role of the freshwater stingray Potamotrygon magdalenae (Duméril 1865) (Myliobatiformes: Potamotrygonidae), combining gut–content and stable isotope analysis. Environ. Biol. Fishes. [Internet]. 2019; 102(8):1119- 1136. doi: https://doi.org/gv9snr [11] Piñeros–Quiceno AM. Incidencia de las listas rojas en la gestión para la conservación de las especies amenazadas a escalas global y nacional (Colombia). [Internet]. 2017 [cited 14 Feb 2025]; Available in: https://goo.su/x2MPo [12] Acosta–Santos AA. Taxonomía, biología reproductiva y usos de rayas de agua dulce (Myliobatiformes: Potamotrygonidae) en el río Amazonas colombiano [dissertation on the Internet]. Leticia, Amazonas (Colombia): Universidad Nacional de Colombia. 2020 [cited 13 Feb 2025]. 158 p. Available in: https://goo.su/njyMSHe

Forensic DNA identiﬁcation of freshwater stingrays / Gelvez et al.____________________________________________________________________ 8 of 8 [13] Ehemann NR, González–González LDV, Tagliafico A, Weigmann S. Updated taxonomic list and conservation status of chondrichthyans from the exclusive economic zone of Venezuela, with ﬁrst generic and speciﬁc records. J. Fish Biol. [Internet]. 2019; 95(3):753-771. doi: https://doi.org/n8c4 [14] Naz S, Chatha AMM, Khan RU. Pragmatic applications of DNA barcoding markers in identiﬁcation of ﬁsh species – A review. Ann. Anim. Sci. [Internet]. 2023; 23(2):363-389. doi: https:// doi.org/n8c5 [15] Pinto IdS, Rodrigues BL, de Araujo–Pereira T, Shimabukuro PHF, de Pita–Pereira D, Britto C, Brazil RP. DNA barcoding of sand flies (Diptera, Psychodidae, Phlebotominae) from the western Brazilian Amazon. Plos One. [Internet]. 2023; 18(2):e0281289. doi: https://doi.org/n8c9 [16] Gonçalves PF, Oliveira–Marques AR, Matsumoto TE, Miyaki CY. DNA barcoding identiﬁes illegal parrot trade. J. Hered. [Internet]. 2015; 106(S1):560-564. doi: https://doi.org/f7nj78 [17] Roccaro M, Bini C, Fais P, Merialdi G, Pelotti S, Peli A. Who killed my dog? Use of forensic genetics to investigate an enigmatic case. Int. J. Legal Med. [Internet]. 2021; 135(2):387-392. doi: https://doi.org/n8df [18] Saldamando CI, Marquez EJ. Aproximación a la ﬁlogenia de Spodoptera (Lepidoptera: Noctuidae) con el uso de un fragmento del gen de la citocromo oxidasa I (COI). Rev. Biol. Trop. [Internet] 2012 [cited 15 Feb 2025]; 60(3):1237-1248. Available in: https://goo.su/3QDtV [19] Wang XB, Zhang JT, Deng J, Zhou QS, Zhang YZ, Wu SA. DNA barcoding of mealybugs (Hemiptera: Coccoidea: Pseudococcidae) from mainland China. Ann. Entomol. Soc. Am. [Internet]. 2016; 109(3):438-446. doi: https://doi.org/f8jx79 [20] Filip E, Strzała T, Stępień E, Cembrowska–Lech D. Universal mtDNA fragment for Cervidae barcoding species identiﬁcation using phylogeny and preliminary analysis of machine learning approach. Sci. Rep. [Internet]. 2023; 13(1):9133. doi: https:// doi.org/n8dn [21] López–Ardila IY, Martínez–Pérez FJ, Rondón–González F. Aplicación del modelo de pérdida de ADN para el diseño de cebadores en Potamotrygon magdalenae (Potamotrygonidae). Acta Biológica Colomb. [Internet]. 2022. [cited 15 Feb 2025]; 27(1):97-103. Available in: https://goo.su/JBaeB07 [22] Kimura M. Estimation of evolutionary distances between homologous nucleotide sequences. Proc. Natl. Acad. Sci. [Internet]. 1981; 78(1):454-458. doi: https://doi.org/b2q45c [23] Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. [Internet]. 2013; 30(12):2725-2729. doi: https://doi.org/5v5 [24] Fontenelle JP, Marques FPL, Kolmann MA, Lovejoy NR. Biogeography of the neotropical freshwater stingrays (Myliobatiformes: Potamotrygoninae) reveals effects of continent–scale paleogeographic change and drainage evolution. J. Biogeogr. [Internet]. 2021; 48(6):1406-1419. doi: https://doi.org/f4b8 [25] Song HM, Mu XD, Wei MX, Wang XJ, Luo JR, Hu YC. Complete mitochondrial genome of the ocellate river stingray (Potamotrygon motoro). Mitochondrial DNA. [Internet]. 2015; 26(6):857-858. doi: https://doi.org/n8ds [26] Toffoli D, Hrbek T, Araújo MLG de, Almeida MP de, Charvet– Almeida P, Farias IP. A test of the utility of DNA barcoding in the radiation of the freshwater stingray genus Potamotrygon (Potamotrygonidae, Myliobatiformes). Genet. Mol. Biol. [Internet]. 2008; 31:324-336. doi: https://doi.org/dh3jj2 [27] Sanches D, Martins T, Lutz Í, Veneza I, SILVA RD, Araújo F, et al. Mitochondrial DNA suggests Hybridization in Freshwater Stingrays Potamotrygon (Potamotrygonidae: Myliobatiformes) from the Xingu river, Amazonia and reveals speciation in Paratrygon aireba. An. Acad. Bras. Ciênc. [Internet]. 2021; 93:e20191325. doi: https://doi.org/n8dt [28] Cerutti–Pereyra F, Meekan MG, Wei NWV, O’Shea O, Bradshaw CJ, Austin CM. Identiﬁcation of rays through DNA barcoding: an application for ecologists. PLoS One. [Internet]. 2012; 7(6):e36479. doi: https://doi.org/g45p28 [29] Pereira LH, Hanner R, Foresti F, Oliveira C. Can DNA barcoding accurately discriminate megadiverse Neotropical freshwater fish fauna? BMC Genet. [Internet]. 2013; 14(1):20. doi: https://doi.org/f4rf9p [30] Li B, Malyarchuk B, He XB, Derenko M. Molecular evolution and adaptation of the mitochondrial cytochrome b gene in the subgenus Martes. Genet. Mol. Res. [Internet]. 2013; 12(3):3944-3954. doi: https://doi.org/n8dv [31] Holmes BH, Steinke D, Ward RD. Identiﬁcation of shark and ray ﬁns using DNA barcoding. Fish Res. [Internet]. 2009;95(2- 3):280-288. doi: https://doi.org/d4g8d6 [32] Loh WKW, Bond P, Ashton KJ, Roberts DT, Tibbetts IR. DNA barcoding of freshwater ﬁshes and the development of a quantitative qPCR assay for the species–speciﬁc detection and quantiﬁcation of ﬁsh larvae from plankton samples. J. Fish Biol. [Internet]. 2014; 85(2):307-328. doi: https://doi. org/f6dbqb [33] Lovejoy NR, Bermingham E, Martin AP. Marine incursion into South America. Nature [Internet]. 1998; 396(6710):421-422. doi: https://doi.org/csg978 [34] Kirchhoff KN, Hauffe T, Stelbrink B, Albrecht C, Wilke T. Evolutionary bottlenecks in brackish water habitats drive the colonization of fresh water by stingrays. J. Evol. Biol. [Internet]. 2017; 30(8):1576-1591. doi: https://doi.org/ghppmb [35] Velasco–Garzón JS, Gutiérrez–Espinosa MC. Aspectos nutricionales de peces ornamentales de agua dulce. Rev. Politécnica [Internet]. 2019; 15(30):82-93. doi: https://doi. org/n8dw [36] Grajales–Hahn S, Hahn–von Hessberg CM, Grajales–Quintero A. Reporte de caso de Aeromonas salmonicida en tilapia nilótica (Oreochromis niloticus) en Caldas, Colombia. Bol. Cientíﬁco Cent. Mus. Mus. Hist. Nat. [Internet]. 2018;22(1):76- 85. doi: https://doi.org/g5j6n2