Received: 19/11/2024 Accepted: 07/01/2025 Published: 11/03/2025 1 of 9

https://doi.org/10.52973/rcfcv-e35574 RevistaCientíca,FCV-LUZ/Vol.XXXV

ABSTRACT

Staphylococcus warneri, an opportunistic pathogen, is a causative

agent of mortal diseases in rainbow trout farming (Oncorhynchus

mykiss), which are of great economic value for Türkiye. In

this study, in addition to traditional phenotypic, biochemical,

histopathological and genetic methods, a high throughput

proteomics based Matrix Assisted Laser Desorption/Ionization

Time of Flight Mass Spectrometry (MALDI–TOF MS) method was

performed for precise identication of S. warneri. Fourteen isolates

obtained from skin, gills, liver, spleen and kidney of a total of fty

diseased sh were phenotypically conrmed as S. warneri using

the BBL Crystal

GP identication system. Only 43% of these

isolates showed positive PCR amplication for the 16S rRNA and

sodA (superoxide dismutase A) gene, while 100% were identied

as S. warneri by MALDI–TOF MS technique with high mass score

value (m/z) between 2.35 and 3.05. From the comparative data

obtained, it was concluded that MALDI–TOF mass spectrometry

analysis can be recommended for the denitive conrmation

of S. warneri, which showed indistinguishably close similarities

with 16S rRNA gene sequences and sodA PCR results. To the

best of knowledge, this is the rst report to validate the results of

phenotypic, biochemical, genetic and histological methods by the

MALDI–TOF MS and shows that this is a successful identication

approach, providing a high mass score (m/z) with 100% matching

for accurate and faster identication of S. warneri. This promising

diagnostic technique can identify many different bacterial sh

pathogens, although a larger protein mass database for aquatic

organisms is needed.

Key words: Staphylococcus warneri; MALDI–TOF MS; BBL

Crystal

GP; 16S rRNA; sodA

RESUMEN

Staphylococcus warneri, un patógeno oportunista, es un agente

causante de enfermedades mortales en la cría de la trucha

arco iris (Oncorhynchus mykiss) de gran valor económico para

Türkiye. En este estudio, además de los métodos fenotípicos,

bioquímicos, histopatológicos y genéticos tradicionales, se

utilizó un método de proteómica de alto rendimiento basado

en la espectrometría de masas por ionización/desorción láser

asistida por matriz (MALDI–TOF MS) para la identicación precisa

de S. warneri. Catorce aislados obtenidos de piel, branquias,

hígado, bazo y riñón de un total de cincuenta peces enfermos

se conrmaron fenotípicamente como S. warneri mediante el

sistema de identicación BBL Crystal

GP. Sólo el 43 % de estos

aislados mostraron una amplicación positiva por PCR para el

gen 16S rRNA y sodA (superóxido dismutasa A), mientras que el

100 % fueron identicados como S. warneri mediante la técnica

MALDI–TOF MS con un alto valor de puntuación de masa (m/z)

entre 2.35 y 3.05. A partir de los datos comparativos obtenidos,

se concluyó que el análisis de espectrometría de masas MALDI–

TOF puede recomendarse para la conrmación denitiva de S.

warneri, que mostró similitudes indistinguiblemente cercanas

con las secuencias del gen 16S rRNA y los resultados de la PCR

sodA. Hasta donde se sabe, éste es el primer informe que valida

los resultados de métodos fenotípicos, bioquímicos, genéticos e

histológicos mediante la MALDI–TOF y demuestra que se trata

de un método de identicación satisfactorio, que proporciona

una puntuación de masa elevada (m/z) con una coincidencia del

100 % para una identicación precisa y más rápida de S. warneri.

Esta prometedora técnica de diagnóstico puede identicar muchos

patógenos bacterianos de peces diferentes, aunque se necesita

una base de datos de masas de proteínas más amplia para los

organismos acuáticos.

Palabras clave: Staphylococcus warneri; MALDI–TOF MS; BBL

Crystal

GP; 16S rRNA; sodA

Identication of Staphylococcus warneri from rainbow trout

(Oncorhynchus mykiss Walbaum, 1792) using proteomics–based

MALDI–TOF MS

Identicación de Staphylococcus warneri en trucha arcoiris (Oncorhynchus mykiss

Walbaum, 1792) mediante espectrometría de masas MALDI–TOF basada en proteómica

Hasan Emre Yılmaz

, İfakat Tülay Çağatay

* , Öznur Diler

, Mevlüt Nazıroğlu

, Öznur Özil

, Şeydanur Kan

Akdeniz University, Institute of Natural and Applied Sciences. Antalya, Türkiye.

Akdeniz University, Faculty of Fisheries, Department of Basic Sciences, Molecular Microbiology Laboratory. Antalya, Türkiye.

Isparta University of Applied Sciences, Eğirdir Faculty of Fisheries, Department of Aquaculture. Isparta, Türkiye.

*Corresponding author: tulaycagatay@gmail.com

Identication of Staphylococcus warneri using MALDI-TOF MS / Yılmaz et al.________________________________________________________

2 of 9 3 of 9

INTRODUCTION

Staphylococcus warneri, a coagulase–negative and opportunistic

pathogen, has been isolated from a variety of sources, including

animals, humans and food products. It is frequently associated

with the development of spontaneous staphylococcal infections [1,

2, 3]. S. warneri has been identiedas the causative agent in sh

disease outbreaks affecting Siberian sturgeon (Acipenser baerii)

[4], catsh (Clarias sp.) [5], bronze gudgeon (Coreius guichenoti)

[6], seven khramulya (Capoeta capoeta) [7] and rainbow trout

[8, 9, 10]. Clinical signs of infection caused by S. warneri include

exophthalmos, abdominal ascites, septicaemia, n lesions and

discoloured kidney and liver [11].

The identifion of S. warneri is typically achieved through

the isolation of bacterium from diseased sh and subsequent

characterisation using biochemical, serological and genetic

methods [9, 10, 11]. However, these methods were not always

sufcient for distinguish between closely related species of the

genus Staphylococcus due to the high degree of similarity in the 16S

rRNA sequences [12]. Consequently, in order to achieve denitive

identication of S. warneri, it is necessary to employ a conformative

method in addition to the traditional techniques.

MALDI–TOF MS a proteomic based method, has proven to be a

powerful diagnostic tool for the determination of microbial diversity

in clinical and environmental microbiology during last 20 years

[13, 14]. Unlike conventional methods, MALDI–TOF MS provides

high throughput, fast, reliable, and easy to use direct strain typing

(without subculture) which is relatively inexpensive and does not

require specialized laboratory skills [15]. In addition, MALDI–TOF

MS provides comparable, sometimes better, results than standard

16S rRNA gene sequencing, allowing taxonomic classication

down to the subspecies level [16, 17].

The MALDI–TOF MS technique allows the identification of

microorganism through protein/peptide proling. The technique

works by passing a laser through a sample of the bacteria in a

specialized matrix solution. The laser energy causes the proteins

in the sample to desorb and ionize. Mass signals from the ionized

microbial ribosomal peptides, rising into an evacuated detection

tube, identify the unique mass ngerprints that each species has

based on their distinctive spectrum of mass/charge ratio (m/z)

peaks [18]. The resulting bacterial peptide mass ngerprints are

compared with those in a mass spectral library of pre–existing

reference strains in the database [19]. The comparison of these

proles with the database allows for identication of bacterial

genus or species based on the peptide composition.

Previous studies have demonstrated that the use of MALDI–TOF

MS technique accurately identied bacterial pathogens [20] of

signicance to sh species such as Vibrio [21], Mycobacterium

[22, 23], Enterobacterales [24], Staphylococcus [2], Tenacibaculum

[25], Photobacterium damselae [26], Streptococcus iniae

[27], Flavobacterium [28], Pseudomonas [29], Renibacterium

salmoninarum [30], Vagococcus salmoninarum [31] and Yersinia

ruckeri. S. warneri has been identied from some aquaculture

food products and sea water using MALDI–TOF MS technique,

however it has not been used for the identication of S. warneri

from rainbow trout.

The principal aim of this study was to develop a rapid and

accurate proteomic approach utilising MALDI–TOF MS technology

for the identication of S. warneri in samples obtained during

staphylococcosis outbreaks on rainbow trout farms. In addition, the

present study sought to evaluate the accuracy of MALDI–TOF MS

analysis in comparison with three conventional diagnostic methods.

The application of MALDI–TOF MS in the context of aquaculture

diseases, bacterial and fungal disease agents is expected to

signicantly improve the speed and accuracy of diagnoses. It

also holds promise in facilitating the assessment of phylogenetic

relationships between closely related bacterial species that have

been difcult to identify.

MATERIALS AND METHODS

Fish sampling and necropsy

The rst sampling of a total of fty dead rainbow trout with

between of 7.5–20 g was carried out in March (2022) when the

disease outbreak was reported from two commercial trout farms

located in the Aegean (n=10) and Mediterranean (n=15) regions,

and the second sampling was carried out in March (2024) from

two different commercial farms in the Mediterranean (n=25)

region and they were transported to the laboratory under sterile

conditions. At the time of sampling, the water temperature in the

ponds was between 11 to 15°C, oxygen 10.8–11.0 ppm and pH

7.0 on average. The external surfaces of freshly dead sh showing

signs of disease were macroscopically examined and the body

surface of the sh was then disinfected with 70–80% ethanol

for necropsy in a biological safety cabinet for dissection. During

necropsy, aseptic samples were taken from ns, skin, gills, liver,

spleen and kidneys for phenotypic, histopathological, genetic and

MALDI–TOF MS analyses.

Bacterial strains and growth conditions

Reference strains S. warneri ATCC 27836, S. pasteuri ATCC

51129 and S. epidermidis ATCC 35538 and clinic samples were

cultured using tryptic soy agar (TSA) and tryptic soy broth (TSB)

(Merck, Germany) at 25°C for 24–48 h [1, 6].

Biochemical identication analysis

Isolated colonies were subcultured and were characterized

using the BBL Crystal™GP system (BD, Becton Dickinson, USA)

according to the manufacturer’s manual.

Antibiotic susceptibility analysis

The isolated colonies were incubated on TSB at 25°C for 24 h for

antimicrobial susceptibility testing determined by Kirby–Bauer disk

diffusion method [32]. The bacterial suspensions were reduced to

0.5 McFarland turbidity. The bacterial samples were inoculated on

a Mueller Hinton agar (MHA) (Merck, Germany) plate containing 5%

sheep blood. Antibiotic disks were placed on the petri dishes. Thirty

antibiotics (Merck, Germany) were used for susceptibility tests,

respectively; Oxolinic Acid, Tetracycline, Penicillin, Amoxicillin,

Nalidixic Acid, Tetracycline, Lincomycin, Nitrofurantoin, Florfenicol,

Kanamycin, Gentamycin, Ofloxacin, Enrofloxacin, Cefoperazone,

Norfloxacin, Vancomycin, Cefurocime, Flumequine, Sulphamethox,

Doxycycline, Apramycin, Cephalothin, Neomycin, Oxacillin,

Identication of Staphylococcus warneri using MALDI-TOF MS / Yılmaz et al.________________________________________________________

_________________________________________________________________________________________________Revista Cientica, FCV-LUZ / Vol.XXXV

3 of 9

Colistin, Ciprofloxacin, Oxytetracycline, Tylosin, Spectinomycin

and Clindamycin antibiotics were evaluated according to Clinical

and Laboratory Standards Institute (CLSI) guidelines The diameters

of the growth zones around the antibiotic disks in these incubated

petri dishes were measured. Isolates and reference strains based

on zone diameters measurement references susceptible (S),

intermediate susceptible (I) and resistant (R) [33].

Histopathological analysis

Ten (S1 to S10) dead sh from different farms with positive

phenotypic, biochemical and genetic analyses were selected for

histopathological analysis. These sh with an average weight of

0.75–20 g were dissected and liver, kidney and spleen tissues

were xed in 10% formaldehyde solution. Tissue samples were

subjected to routine tissue tracing and embedded in parafn.

Tissues were sectioned at 5 μm with a microtome (Leica RM2155,

Leica Microsystems, Wetzlar, Germany). Tissue sections were

stained with hematoxylin and eosin and examined under a light

microscope (Olympus CX21, Olympus Corporation, Tokyo, Japan)

following staining with hematoxylin and eosin.

Analysis of 16S rRNA and sodA genes

The DNeasy blood and tissue kit (Qiagen, USA) was used to

extract DNA from seventeen bacterial cultures following the

manufacturer’s manual. 16S rRNA and sodA genes were amplied

by polymerase chain reaction (PCR) [12, 34]. PCR protocols and

specic primer sets are listed in TABLE I. PCR amplicons of the

16S rRNA gene from RS1, 2, 3 and S1 to S6 were puried and

sequenced by Macrogen (Holland) (TABLE I).

BioEdit 7.2 (Ibis Biosciences, USA) was employed to align

the DNA sequences. The BLAST program was used to assess

the identity of concatenated sequences by comparing them to

reference sequences in the GenBank database. The ClustalW

algorithm was used in Molecular Evolutionary Genetics Analysis

(MegaX) software for phylogenetic tree construction and the

jModelTest was used to determine the mutation model of the

aligned sequences. MrBayes v3.2 was used for phylogenetic

tree construction. Four chains were subjected to Markov chain

Monte Carlo (MCMC) analysis, which was carried out for 10

million generations until the split frequency reduced below 0.01.

Every 1000 generations, 25% of the trees obtained by sampling

were considered “burn–in” and removed. The consensus tree

obtained as a result of the analysis was edited in FigTree v1.4.2.

The identication was considered reliable if the identication rate

was greater than or equal to 100% for the genus level.

MALDI–TOF MS analysis

Reference strains (RS1, 2, 3) and freshly cultured isolates

(S1-S14) were subjected to analysis using the MALDI–TOF

Biotyper (Bruker, Germany). It was performed according to protocol

developed by Popovic et al. [19] using the on–target extraction

method after 24 h of incubation on TSA medium. A wooden stick

was used to place an individual colony onto a 96 spot target plate.

Following that, each bacterial colony was overlaid by 1.0 μL of

70% formic acid (Kemika, Croatia) to lyse the bacterial cells and

release the proteins. After the formic acid had dried, 1.0 μL of α–

Cyano-4-hydroxycinnamicacid (CHCA–matrix solution) (Bruker

Daltonics, Germany) was applied to each spot and allow to dry

at room temperature to allow for optimal protein crystallization

[26]. A microflex mass spectrometer equipped with an laser under

ion detection mode at a frequency of 60 Hz and MALDI Bruker

Biotyper 3.4 software (Bruker Daltonics, Germany) was performed

for the collection of MALDI–TOF MS and peak identication of

colonies from the bacterial isolates. For each sample examined

mass spectra in the range of 2000 to 21000 Da were obtained.

The spectra were constructed using 240 single spectra that were

acquired from each isolate at random places using 40 laser shot

stages. Each peak’s comparison to the database’s reference mass

spectra recorded in ratings from 0 to 3.00 on a logarithmic scale.

The criteria for a successful identication appeared reliable at the

species level if the number was higher than 2.00 [15, 22].

RESULTS AND DISCUSSION

Phenotypic evaluation

External examination of fteen infected rainbow trout showed

bilateral exophthalmos in the eyes, hemorrhage and dropsy in

the lower jaw. In addition, anemia in the kidney and liver, yellow

green fluid in the digestive tract, hemorrhage in the adipose tissue

and anus, and enlarged spleen tissue were detected in internal

examination of this study after necroscopy. In a study reported

in the Gil et al. [11] reported ulcerated skin lesions on the ns of

rainbow trout infected with S. warneri, exophthalmos, acidic fluid

TABLE I

Primers and PCR protocols for 16S rRNA and sodA gene amplications

Gene Primer Sequence (5’-3’) Size Conditions Protocol References

16S rRNA

63f

1387r

CAGGCCTAACACATGCAAGTC

GGGCGGWGTGTACAAGGC

1300 bp

1×PCRbuer,1.5mMMg

,1pmolf/r

primers,0.5mMdNTPmix,1UTaq

sodA

PA237F

PA237R

GCTAATTTAGACAGTGTACCTTCTG

GCCCGTTATTTACTACTAACCA

237 bp

1×PCRbuer,1.5mMMg

,1pmolf/r

primers,0.5mMdNTPmix,1UTaq

SW110F

SW110R

GTAACAAAATTAAATGCAGCTG

TCTTACTGCAGTTTGAATATCAGA

110 bp

1×PCRbuer,1.5mMMg

,1pmolf/r

primers,0.5mMdNTPmix,1UTaq

Identication of Staphylococcus warneri using MALDI-TOF MS / Yılmaz et al.________________________________________________________

4 of 9 5 of 9

accumulation in the abdomen and anaemia in the liver. Metin

et al. [9] reported lethargy, anorexia, abrasion on anal n bases,

haemorrhage in eyes, jaw and mouth, darkening of colour, anaemia

in internal organs, petechial haemorrhage in liver, splenomegaly

and yellow exudate in intestine in the infection caused by S. warneri

in broodstock rainbow trout weighing 1500–2000 g. In this study,

unlike Gil et al. [11] and Metin et al. [9] and similar to the Diler et al.

[10], there was no change in the skin in the external examination of

infected juvenile rainbow trout, but the symptoms such as bilateral

exophthalmos in the eyes, haemorrhage in the lower jaw, dropsy,

anaemia in the internal organs, yellow exudate in the digestive

tract, haemorrhage in the adipose tissue, haemorrhage in the anus

region and enlargement in the spleen tissue were similar (FIG. 1).

Biochemical characterization

Single colonies with a diameter of 1.5-2.0 mm were observed

as a result of bacterial cultivation on TSA medium from the

anterior kidney, liver and spleen tissues of sh (FIG. 2). Gram

staining of the obtained isolates showed gram–positive and

staphylococcal morphology.

Fourteen isolates (S1 to S14) were identied as S. warneri using

the commercial BBL Crystal

GP kit for phenotypic characterisation

and identication and compared with the reference strain (S.

warneri ATCC 27836) (TABLE II). Thirty antibiotics were used for

antibiotic susceptibilities of bacterial isolates evaluated by disk

diffusion test (TABLE II). As a result, the isolates were found to

be susceptible (S) to fourteen antibiotics (Florfenicol, Kanamycin,

Gentamycin, Ofloxacin, Enrofloxacin, Cefoperazone, Norfloxacin,

Vancomycin, Flumequine, Cefurocime, Sulphamethox, Doxycycline,

Apramycin and Cephalothin), resistant (R) to eight (Neomycin,

Oxacillin, Colistin, Ciprofloxacin, Oxytetracycline, Tylosin,

Spectinomycin and Clindamycin) and intermediate susceptible

(I) to Oxolinic acid, Tetracycline, Penicillin, Amoxicillin, Nalidixic

acid, Tetracycline, Nitrofurantoin and Lincomycin. In this study,

S. warneri isolated from rainbow trout were found to be sensitive

to Florfenicol, Enrofloxacin, Doxycyclin, Clindamycin, Kanamycin,

Gentamicin, Vancomycin antibiotics. The ndings were consistent

to the results of Metin et al. [9] and Diler et al. [10]. Xiao et al.

[6] reported that S. warneri species were, however, susceptible

to Streptomycin, Doxycycline, Amicacin, Florfenicol antibiotics

and the disease was effectively controlled with Doxycycline in

infected sh.

Histopathological evaluation

The histopathological examinations in this study, inflammatory

inltration around the vena centralis in liver tissue, hyperaemia

in spleen tissue, red pulp, loss of white pulp border, splenitis

and necrotic changes in renal tubule epithelium were observed

in rainbow trout infected with S. warneri (FIG. 3). Although

histopathological analyses are an important method that reveal the

damage caused by sh pathogens in tissues and can give results

in the diagnosis of some diseases, research on the pathological

disorders caused by S. warneri in fish tissues has remained

very limited. The ndings of this study were consistent with the

ndings of Diler et al. [10] and Xiao et al. [6]. Rusev et al. [4]

investigated the effects of Shewanella putrefaciens and S. warneri

together on sh tissues in sturgeon (Acipenser baerii) and hybrid

sturgeon (Huso huso × A.baerii). Pathological ndings showed

hyperaemia in the spleen, supercial petechial haemorrhages

in the liver and hyperaemia in the mesenteric blood vessels. In

another study, histopathological examinations were performed in

infections caused by S. pasteuri in sturgeon (A. gueldenstaedtii) and

lymphocyte inltration around necrotic hepatocyte cells; necrosis

in the kidney, hyperaemia in the spleen and intense haemorrhagic

areas were determined [35].

FIGURE 1. A) Exophthalmus in the eyes of juvenile sh, B) Bleeding in the lower

jaw, C) Anemic pale liver D) Haemorrhages in adipose tissue, enlarged spleen

FIGURE 2. Morphology of colonies on TSA medium thought to be Staphylococcus

warneri (S6) isolated from kidney tissue

Identication of Staphylococcus warneri using MALDI-TOF MS / Yılmaz et al.________________________________________________________

_________________________________________________________________________________________________Revista Cientica, FCV-LUZ / Vol.XXXV

5 of 9

TABLE II

Biochemical characterization of isolates and Staphylococcus warneri ATCC 27836 by BBL Crystal™ GP identication system and antibiotic susceptibility

Characteristics

S. warneri

ATCC 27836

Sensitivity of Isolates

1 2 3 4 5 6 7 8 9 10 11 12 13 14

Hemolysis

α α α α α α α α α α α α α α α

Growth at               

20-22

C + + + + + + + + + + + + + + +

25-27

C + + + + + + + + + + + + + + +

30-35

C + + + + + + + + + + + + + + +

Growth in   

Arabinose - - - - - - - - - - - - - - -

Sucrose + + + + + + + + + + + + + + +

Mannose + + + + + + + + + + + + + + +

Melibiose + + + + + + + + + + + + + + +

Sorbitol - - - - - - - - - - - - - - -

Rhamnose - - - - - - - - - - - - - - -

Adonitol - - - - - - - - - - - - - - -

Mannitol + + + + + + + + + + + + + + +

Galactose + + + + + + + + + + + + + + +

Inositol - - - - - - - - - - - - - - -

p–nitrophenylgalactosidase + + + + + + + + + + + + + + +

Urea - - - - - - - - - - - - - - -

Glycine + + + + + + + + + + + + + + +

Treazolium + + + + + + + + + + + + + + +

Arginine - - - - - - - - - - - - - - -

Lysine - - - - - - - - - - - - - - -

Esculin

+ + + + + + + + + + + + + + +

p–nitrophenylα–β–Glucosidase + + + + + + + + + + + + + + +

Antibiotics               

Oxolinicacid I I I I I I I I I I I I I I I

Tetracycline I I I I I I I I I I I I I I I

Penicillin I I I I I I I I I I I I I I I

Amoxicillin I I I I I I I I I I I I I I I

NalidixicAcid I I I I I I I I I I I I I I I

Tetracycline I I I I I I I I I I I I I I I

Lincomycin I I I I I I I I I I I I I I I

Nitrofurantoin I I I I I I I I I I I I I I I

Florfenicol S S S S S S S S S S S S S S S

Kanamycin S S S S S S S S S S S S S S S

Gentamycin S S S S S S S S S S S S S S S

Ooxacin S S S S S S S S S S S S S S S

Enrooxacin S S S S S S S S S S S S S S S

Cefoperazone S S S S S S S S S S S S S S S

Noroxacin S S S S S S S S S S S S S S S

Vancomycin S S S S S S S S S S S S S S S

Flumequine S S S S S S S S S S S S S S S

Cefurocime S S S S S S S S S S S S S S S

Sulphamethox S S S S S S S S S S S S S S S

Doxycycline S S S S S S S S S S S S S S S

Apramycin S S S S S S S S S S S S S S S

Cephalothin S S S S S S S S S S S S S S S

Neomycin R R R R R R R R R R R R R R R

Oxacillin R R R

R R R R R R R R R R R R

Colistin R R R R R R R R R R R R R R R

Ciprooxacin R R R R R R R R R R R R R R R

Oxytetracycline R R R NC R R R NC R R R R R R R

Tylosin R R R R R R R R R R R R R R R

Spectinomycin R R R R R R R R R R R R R R R

Clindamycin R R R R R R R R R R R R R R R

(+:positive,–:negative,α:Alphahemolysis,NC:nocalculation,S:susceptible,I:intermadiatesusceptible,R:resistant)

Identication of Staphylococcus warneri using MALDI-TOF MS / Yılmaz et al.________________________________________________________

6 of 9 7 of 9

Genetic characterization

Fourteen phenotypically and histopathologically examined

bacterial isolates (S1–S14) were also identied by genetic method.

In the conventional PCR conducted using 16S rRNA primers on

fourteen clinical isolates, the gene amplicon of 240 bp size was

found to be positive in 43% of the cases, confirming it as S.

warneri. (TABLE III). The positive PCR results of the 16S rRNA

gene in this study were compared with previous studies, and it was

observed that amplicons of the same size were obtained. [6, 10,

11]. Moreover, the 16S rRNA gene was sequenced for six samples

(S1 to S6) randomly selected from fourteen samples and it was

observed that the 16S rRNA gene sequence published in GenBank

under accession numbers OR144346–1, 2, 3 and OR144347–1,

2, 3 had 100% homology with S. warneri (FIG. 4). Kim et al. [12]

and Iwase et al. [36] previously reported that although 16S rRNA

analyses are frequently used to identify various bacterial species,

they cannot discriminate and misidentify between closely related

species such as Staphylococcus spp. Therefore, to distinguish

between the two closely related species S. warneri and S. pasteuri

and to validate the results, a species–specic sodA gene PCR was

additionally performed, and it was found that only 50% of the

fourteen isolates were positive in the sodA–targeted PCR.

As a result of MALDI–TOF analyses, the reference strains and all

isolates were identied with m/z score values greater than 2.00.

FIGURE 3. A–B: Degenerative and necrotic changes in kidney tubule cells, C:

Inammatory cells in spleen, D: Inammatory inltration in the hepatic central

vena stage

TABLE III

Comparison of the results of phenotypic, genetic methods and MALDI TOF in the identication of Staphylococcus warneri

No Isolate / Strain

BBL Crystal™ GP

Identication

PCR Results 16S rRNA Sequencing Result MALDI–TOF Identication

16S rRNA

gene

Partial sodA

gene

Staphylococcus sp.

AC no

Similarity

Scores (%)

Best Match

Bacteria

Log Scores

RS 1

S. warneri

ATCC 27836

+ + +

S. warneri

MH426978-1

100

S. warneri

ATCC27836

3.00

RS 2

S. epidermidis

ATCC 35538

- - -

S. epidermidis

L37605-1

100

S. epidermidis

ATCC 35538

2.80

RS 3

S. pasteuri

ATCC 51129

- - -

S. pasteuri

KJ623586

100

S. pasteuri

ATCC 51129

3.00

S 1 CI 1 + + +

S. warneri_1

OR144346

100

S. warneri

ATCC27836

2.50

S 2 CI 2 + + +

S. warneri_2

OR144346

100

S. warneri

ATCC27836

3.00

S 3 CI 3 + + +

S. warneri_3

OR144346

100

S. warneri

CICC 23992

2.93

S 4 CI 4 + + +

S. warneri_1

OR144347

100

S. warneri

CCUG7325T

2.40

S 5 CI 5 + + +

S. warneri_2

OR144347

100

S. warneri

5353_2014

2.50

S 6 CI 6 + + +

S. warneri_3

OR144347

100

S. warneri

ATCC27836

3.00

S 7 CI 7 + - - NA NA

S. warneri

ATCC27836

2.86

S 8 CI 8 + - - NA NA

S. warneri

Mb18796_1CHB

3.00

S 9 CI 9 + - - NA NA

S. warneri

ATCC27836

3.00

S 10 CI 10 + - - NA NA

S. warneri

ATCC27836

3.00

S 11 CI 11 + - - NA NA

S. warneri

DSM20316

3.05

S 12 CI 12 + - - NA NA

S. warneri

DSM20316

2.93

S 13 CI 13 + - - NA NA

S. warneri

5353_2014

2.80

S 14 CI 14 + - - NA NA

S. warneri

CCUG7325T

2.35

(Referencestrain;RS,Sample;S,ClinicalIsolate;CI)

Identication of Staphylococcus warneri using MALDI-TOF MS / Yılmaz et al.________________________________________________________

_________________________________________________________________________________________________Revista Cientica, FCV-LUZ / Vol.XXXV

7 of 9

The isolates between S1 and S14 were conrmed as S. warneri

with mass scores ranging from 2.35 to 3.05. TABLE III summarizes

the MALDI–TOF MS analysis results obtained for fourteen isolates

(S1–14) and associated bacterial identication match for the

Staphylococcus reference strains.

Besides, FIG. 5 shows the peptide mass ngerprint spectra

obtained for Staphylococcus reference strains (A) and isolates

called S. warneri (S6) (B). For S. warneri, 2803.295, 4307.366,

5907.798, 8094.116, 9630.956 and 10209.725 Da represent

peptide mass ngerprint spectra containing a total of six very

consistent mass peaks. The comparison of these characteristic

peak results obtained by the MALDI–TOF MS method with

reference spectra in the proteomic mass database shows that

the bacteria were identied and distinguished as S. warneri with

100% accuracy. Numerous studies on the accurate identication

of the majority of sh pathogenic bacteria using either MALDI–TOF

MS alone or together with other identication techniques have

been found in the literature [20]. In some studies, comparative

16S rRNA gene sequencing or PCR analysis has been conducted

to show the similarities and phylogenetic relationships among

Staphylococcus species [1, 2, 5, 6, 17]. Yet, no study has been

found that compared MALDI–TOF MS analysis with the traditional

techniques for identifying S. warneri in rainbow trout.

CONCLUSION

The results presented herein compare conventional and

proteomic MALDI–TOF MS analyses to conrm the identication

of isolates obtained from diseased rainbow trout in Türkiye as S.

warneri. This study demonstrated that the MALDI–TOF method

is a rapid (2–3 min), cost–effective (~2$ USD) and accurate

FIGURE 4. Phylogenetic tree based on 16S rRNA gene of six Staphylococcus warneri

isolates (S1 to S6) that published in GenBank and phylogenetically close members

of Staphylococcus

FIGURE 5. MALDI–TOF mass peptide proles of reference strains (A) and Staphylococcus warneri (Sample 6) (B) in the range of 2384.646 to 11636.390 Da

Identication of Staphylococcus warneri using MALDI-TOF MS / Yılmaz et al.________________________________________________________

8 of 9 9 of 9

technique that could be used as an alternative to other diagnostic

methods used to differentiate genetically similar bacterial species

such as S. warneri and S. pasteuri. Further research into how

MALDI–TOF MS can be applied to aquaculture is warranted,

such as identication of slow–growing sh bacteria and the direct

identication of pathogens from tissues without culturing. In order

to make MALDI–TOF MS more accessible and user–friendly for

aquaculture practitioners, efforts should be made to improve

sample preparation methods and speed up data analysis. This

would strongly contribute to future developments in disease

diagnosis and the promotion of sustainable aquaculture. However,

for precise categorization and identication of sh diseases, more

proteomic data need to be submitted to international databases.

The widespread application of this technique in the field of

aquaculture diseases will contribute to early disease diagnosis,

rapid and effective treatment, and will also promote healthier sh

populations and sustainability in aquaculture.

ACKNOWLEDGMENTS

The authors would like to thank Akdeniz University, Central

Research Laboratory for the use of the MALDI–TOF instrument.

Conct of interest

The author declare no competing interests.

Animal Ethics

Ethical approval was not required.

Funding

There is no funding.

Field Study Permissions

Field study permissions was not required.

BIBLIOGRAPHIC REFERENCES

[1] Dubois D, Leyssene D, Chacornac JP, Kostrzewa M, Schmit

PO, Talon R, Bonnet R, Delmas J. Identication of a variety of

Staphylococcus species by matrix–assisted laser desorption

ionization–time of flight mass spectrometry. J. Clin. Micro.

[Internet]. 2010; 48(3):941-945. doi: https://doi.org/bx4fqr

[2] Regecová I, Vyrostková J, Zigo F, Pipová M, Jevinová P,

Demjanová S. Identication of Staphylococcus spp. isolated

from food by two methods. J. Micro. Biotech. Food Sci.

[Internet]. 2021; 10(4):546-552. doi: https://doi.org/n9rj

[3] Yılmaz DK, Berik N. Phenotypic and genotypic antibiotic

resistance of Staphylococcus warneri and Staphylococcus

pasteuri isolated from stuffed mussels. Aquat. Sci. Eng.

[Internet]. 2024; 39(3):172-178. doi: https://doi.org/n9rm

[4] Rusev V, Rusenova N, Simeonov R, Stratev D. Staphylococcus

warneri and Shewanella putrefaciens coinfection in Siberian

sturgeon (Acipenser baerii) and Hybrid sturgeon (Huso

husoxAcipenser baerii). J. Microbiol. Exp. [Internet]. 2016;

3(1):00078. doi: https://doi.org/n9rp

[5] Prihanto AA, Nursyam H, Dayuti S, Hayati RL, Afifah J,

Rachmawati D. Molecular identication of Staphylococcus

sp. isolated from catsh (Clarias sp.) and its antibacterial

activities. [Internet]. AIP Conf. Proc. 2019; 2120(1):080007.

doi: https://doi.org/n9rr

[6] Xiao Z, Xue M, Wu X, Zeng L, Zhu Y, Jiang N, Fan T, Zhou Y.

Isolation and identication of Staphylococcus warneri from

diseased Coreius guichenoti. Aquac. Rep. [Internet]. 2022;

22:100988. doi: https://doi.org/n9rt

[7] Akaylı T, Urku C, Bozkurt, ER. Determination of co–infection

in diseased seven khramulya (Capoeta capoeta). KSÜ Tarım

ve Doğa Derg. [Internet]. 2019; 22(6):965-971. doi: https://

doi.org/n9rw

[8] Musharraeh R, Tacchi L, Trujeque J, LaPatra S, Salinas I.

Staphylococcus warneri, a resident skin commensal of rainbow

trout (Oncorhynchus mykiss) with pathobiont characteristics.

Vet. Microbiol. [Internet]. 2014; 169(1-2):80-88. doi: https://

doi.org/f5s68w

[9] Metin S, Kubilay A, Onuk E, Didinen E, Yildirim P. First isolation

of Staphylococcus warneri from cultured rainbow trout

(Oncorhynchus mykiss) broodstock in Turkey. Bull. Euro. Ass.

Fish Pathol. [Internet]. 2014 [cited 20 Aug. 2024]; 34(5):165-

174. Available in: https://goo.su/5UdwLG5

[10] Diler Ö, Yılmaz HE, Çağatay IT, Nazıroğlu M, Özil Ö, Kan Ş.

Identication and histopathology of Staphylococcus warneri

in rainbow trout (Oncorhynchus mykiss). Acta Aqua. Turcica.

[Internet]. 2023; 19(3):277-288. doi: https://doi.org/n9rz

[11] Gil P, Vivas J, Gallardo CS, Rodriguez LA. First isolation

of Staphylococcus warneri, from diseased rainbow trout,

Oncorhynchus mykiss (Walbaum), in Northwest Spain. J. Fish

Dis. [Internet]. 2000; 23(4):295-298. doi: https://doi.org/dt6wz5

[12] Kim J, Hong J, Lim JA, Heu S, Roh E. Improved multiplex

PCR primers for rapid identication of coagulase–negative

staphylococci. Arch. Microbiol. [Internet]. 2018; 200:73-83.

doi: https://doi.org/gcvr8c

[13] Anwer R, Darami H, Almarri FK, Albogami MA, Alahaydib F.

MALDI–TOF MS for rapid analysis of bacterial pathogens

causing urinary tract infections in the Riyadh Region. Dis.

[Internet]. 2022; 10(4):78. doi: https://doi.org/n9r5

[14] Ashfaq MY, Da’na DA, Al–Ghouti, MA. Application of MALDI–

TOF MS for identication of environmental bacteria: A review.

J. Environ. Manag. [Internet]. 2022; 305(1):114359. doi:

https://doi.org/gzm352

[15] Surányi BB, Taczman–Brückner A, Mohácsi–Farkas C,

Engelhardt T. Rapid identication of bacteria from agricultural

environment using MALDI–TOF MS. Acta Aliment. [Internet].

2023; 52(1):113-120. doi: https://doi.org/gt7wjh

[16] Böhme K, Fernández–No IC, Pazos M, Gallardo JM, Barros–

Velázquez J, Cañas B, Calo–Mata P. Identification and

classication of seafood borne pathogenic and spoilage

bacteria: 16S rRNA sequencing versus MALDI–TOF MS

ngerprinting. Electrophoresis [Internet]. 2013; 34(6):877-

887. doi: https://doi.org/f2d2kx

Identication of Staphylococcus warneri using MALDI-TOF MS / Yılmaz et al.________________________________________________________

_________________________________________________________________________________________________Revista Cientica, FCV-LUZ / Vol.XXXV

9 of 9

[17] Strejcek M, Smrhova T, Junkova P, Uhlik O. Whole–cell MALDI–

TOF MS versus 16S rRNA gene analysis for identication and

dereplication of recurrent bacterial isolates. Front. Microbiol.

[Internet]. 2018; 9:1294. doi: https://doi.org/gfb5jq

[18] Piamsomboon P, Jaresitthikunchai J, Hung TQ, Roytrakul

S, Wongtavatchai J. Identication of bacterial pathogens in

cultured sh with a custom peptide database constructed

by matrix–assisted laser desorption/ionization time–of–

flight mass spectrometry (MALDI–TOF MS). BMC Vet. Res.

[Internet]. 2020; 16(52):1-10. doi: https://doi.org/n9r8

[19] Popović NT, Kazazić SP, Bojanić K, Strunjak–Perović I, Čož–

Rakovac R. Sample preparation and culture condition effects

on MALDI–TOF MS identication of bacteria: A review. Mass

Spectron. Rev. [Internet]. 2021; 42(5):1589-1603. doi:

https://doi.org/jdrm

[20] Çağatay İT. Use of proteomic–based MALDI–TOF mass spectra

for identication of bacterial pathogens in aquaculture: a

review. Aquac. Int. [Internet]. 2024; 32:7835-7871. doi:

https://doi.org/gt7wjk

[21] Boonstra M, Fouz B, van Gelderen B, Dalsgaard I, Madsen

L, Jansson E, Amaro C, Haenen, O. Fast and accurate

identication by MALDI–TOF of the zoonotic serovar E of

Vibrio vulnicus linked to eel culture. J. Fish Dis. [Internet].

2023; 46(4):445-452. doi: https://doi.org/n9sd

[22] Puk K, Banach T, Wawrzyniak A, Adaszek L, Ziętek J,

Winiarczyk S, Guz L. Detection of Mycobacterium marinum,

M. peregrinum, M. fortuitum and M. abscessus in aquarium

sh. J. Fish Dis. [Internet]. 2018; 41(1):153-156. doi: https://

doi.org/gnccr9

[23] Tütmez ÇS, Özbey Ü, Tanrıverdi ES, Aksu Ö, Otlu B, Özbey

G. Identication of Aeromonas species in trout in Tunceli

province by MALDI–TOF MS method. J. Popul. Ther. Clin.

Pharmacol. [Internet]. 2023; 30(11):e346-e354.doi: https://

doi.org/n9sf

[24] Zakrzewski AJ, Zarzecka U, Chajęcka–Wierzchowska W,

Zadernowska A. A comparison of methods for identifying

Enterobacterales isolates from sh and prawns. Pathogens

[Internet]. 2022; 11(4):410. doi: https://doi.org/n9sh

[25] Bridel S, Bourgeon F, Marie A, Saulnier D, Pasek S, Nicolas P,

Bernardet JF, Duchaud E. Genetic diversity and population

structure of Tenacibaculum maritimum, a serious bacterial

pathogen of marine sh: From genome comparisons to high

throughput MALDI–TOF typing. Vet. Res. [Internet]. 2020;

51(60):1-17. doi: https://doi.org/n9sm

[26] Kazazić SP, Popović NT, Strunjak–Perović I, Florio D,

Fioravanti M, Babić S, Čož–Rakovac R. Fish Photobacteriosis–

The importance of rapid and accurate identification of

Photobacterium damselae subsp. piscicida. J. Fish Dis.

[Internet]. 2019; 42(8):1201-1209. doi: https://doi.org/gt7wjf

[27] Pirollo T, Perolo A, Mantegari S, Barbieri I, Scali F, Alborali

GL, Salogni C. Mortality in farmed European eel (Anguilla

anguilla) in Italy due to Streptococcus iniae. Acta Vet. Scand.

[Internet]. 2023; 65(5):1-8. doi: https://doi.org/n9sp

[28] Pérez–Sancho M, Vela AI, Wiklund T, Kostrzewa M, Domínguez

L, Fernández Garayzábal JF. Differentiation of Flavobacterium

psychrophilum from Flavobacterium psychrophilum–like

species by MALDI–TOF mass spectrometry. Res. Vet. Sci.

[Internet]. 2017; 115:345-352. doi: https://doi.org/gcqg9h

[29] Kačániová M, Klūga A, Kántor A, Medo J, Žiarovská J, Puchalski

C, Terentjeva M. Comparison of MALDI–TOF MS biotyper and

16S rDNA sequencing for the identication of Pseudomonas

species isolated from sh. Microb. Pathog. [Internet]. 2019;

132:313-318. doi: https://doi.org/gk8frm

[30] Jia B, Burnley H, Gardner IA, Saab ME, Doucet A, Hammell

KL. Diagnosis of Renibacterium salmoninarum infection in

harvested Atlantic salmon (Salmo salar L.) on the east coast

of Canada: Clinical ndings, sample collection methods and

laboratory diagnostic tests. J. Fish Dis. [Internet]. 2023;

46(5):575-589. doi: https://doi.org/n9sq

[31] Torres–Corral Y, Santos Y. Identification and typing of

Vagococcus salmoninarum using genomic and proteomic

techniques. J. Fish Dis. [Internet]. 2019; 42(4):597-612. doi:

https://doi.org/gt7wjd

[32] Liu C, Zhao X, Xie H, Zhang X, Li K, Ma C, Fu Q. Whole

genome sequence and comparative genome analyses of

multi–resistant Staphylococcus warneri GD01 isolated

from a diseased pig in China. PloS One. [Internet]. 2020;

15(5):e0233363. doi: https://doi.org/n9sr

[33] Weinstein MP, Lewis JS. The clinical and laboratory standards

institute subcommittee on antimicrobial susceptibility testing:

background, organization, functions, and processes. J. Clin.

Microbiol. [Internet]. 2020; 58(3):e01864-19. doi: https://

doi.org/gmx5zm

[34] Marchesi J, Sato T, Weightman AJ, Martin TA, Fry JC, Hiom

SJ, Wade WG. Design and evaluation of useful bacterium–

specic PCR primers that amplify genes coding for bacterial

16S rRNA. Appl. Environ. Microbiol. 1998; 64(2):795-799.

doi: https://doi.org/grdzdj

[35] Atanasoff A, Urku C. Isolation of Staphylococcus pasteuri in

the cultured Russian sturgeon (Acipenser gueldenstaedtii) in

Bulgaria. J. Anim. Plant Sci. [Internet]. 2022; 32(4):961-967.

doi: https://doi.org/n9ss

[36] Iwase T, Seki K, Shinji H, Mizunoe Y, Masuda S. Development

of a real–time PCR assay for the detection and identication

of Staphylococcus capitis, Staphylococcus haemolyticus and

Staphylococcus warneri. J. Med. Microbiol. [Internet]. 2007;

56(10):1346-1349. doi: https://doi.org/cmckzs