Received: 21/10/2024 Accepted: 29/11/2024 Published: 06/01/2025 1 of 6
https://doi.org/10.52973/rcfcv-e35545 Revista Cientíca, FCV-LUZ / Vol. XXXV
ABSTRACT
This study involved clinical and genetic analysis of 15 female
dogs with mammary tumors. Fourteen healthy female dogs
were used as controls, and blood samples were collected from
them for genetic analysis. Polymorphisms located in a splicing
region of the largest exon of the BRCA1 gene were studied,
both at the population and evolutionary level, in a population of
female dogs with different histopathological types of mammary
tumors. In the intron 9–10/exon 10 initiation region, two SNP–
type polymorphisms are described: SNP1 and SNP2. The SNP1
produces a non–synonymous change with unknown effect on
the coding protein. Selected animals underwent surgery, and
samples were sent for histopathological analysis. Peripheral blood
was also collected for DNA extraction. A region corresponding to
intron 9–10/exon 10 of the BRCA1 gene (ENSCAFE00845051080)
was amplied by endpoint PCR, with PCR results subsequently
confirmed through agarose gel electrophoresis at 1%. PCR
products were sequenced to study the polymorphisms identied
within this region. No statistically signicant differences were
observed between the genotype frequencies in both populations
(Chi
2
0.33, P>0.5), indicating that SNP1 is not linked to mammary
tumors in the studied animals. Regarding SNP2, the mutation
was not identied in the studied groups (females with mammary
tumors and controls), being monomorphic. Although this SNP2 is
described in the Ensembl database, there are no genotyping data in
reference populations. The phylogenetic analysis of the amplied
intron 9–10/exon 10 revealed an evolutionary homology with Canis
lupus familiaris, and a more distant relationship with other genera
such as Vulpes and Nyctereutes within the Canidae family. It can be
concluded that mutations in this splicing region of the largest exon
of BRCA1 are not associated with the development of mammary
tumors in canines within this group of animals.
Key words: Canine mammary tumors; canine BRCA1 gene; SNP
RESUMEN
Se realizó el estudio clínico y genético en 15 perras con tumores
de mama. El grupo control incluyó 14 perras sanas a las cuales
se les extrajo sangre para el estudio genético. Se estudió a nivel
poblacional y evolutivo, polimorsmos localizados en una región
de corte y empalme del exón más grande del gen BRCA1 en una
población de perras con distintos tipos histopatológicos de tumores
mamarios. En la región de inicio de intrón 9–10/exón10 hay
descritos dos polimorsmos de tipo SNP: SNP1 y SNP2. El SNP1
produce un cambio no sinónimo y se desconoce el efecto del mismo
a nivel de la proteína codicante. Los pacientes fueron intervenidos
quirúrgicamente, con posterior estudio histopatologico, y obtención
de muestras de sangre para la extracción de ADN. Se amplicó por
PCR a tiempo nal una región correspondiente al intrón 9–10/exón
10 del gen BRCA1 (ENSCAFE00845051080), conrmándose los
resultados por PCR a través de electroforesis en geles de agarosa
al 1 %. Los productos de PCR se secuenciaron para estudiar
los polimorsmos identicados en dicha región. No existieron
diferencias estadísticamente signicativas entre las frecuencias
genotípicas en ambas poblaciones (Chi
2
0.33, P>0,5), por lo tanto,
este SNP1 no estaría vinculado con los tumores mamarios en los
animales estudiados. En referencia al SNP2, en ambos grupos
estudiados, no fue identicada la mutación siendo monomórco.
Si bien este SNP2 se encuentra descrito en la base Ensembl, no
existen datos de genotipado en poblaciones de referencia. La
secuencia amplicada intrón 9–10/exón 10 a nivel logenético
mostró homología con la especie Canis lupus familiaris y relación
más lejana con otros géneros como Vulpes y Nyctereutes de la
familia Canidae. Concluimos que las mutaciones en esta región
de splicing del mayor exón de BRCA1 no estarían relacionadas
con la aparición de tumores mamarios en caninos en este grupo
de animales.
Palabras clave: Tumores mamarios caninos; BRCA1 canino; SNP
Analysis of genetic polymorphisms in the intron 9–10/exon 10 region
of the BRCA1 gene in a population sample of dogs with mammary
cancer from Uruguay
Análisis de polimorsmos genéticos en la región intrón 9–10/exón 10 del gen
BRCA1 en una muestra poblacional de perras con cáncer de mama de Uruguay
Alicia Decuadro
1
* , Micaela Sosa
1
, Federico García
1
, Nariné Balemian
2
, María del Carmen Montenegro
2
, Silvia Llambí
2
1
Universidad de la República, Facultad de Veterinaria, Unidad Académica de Clínica de Pequeños Animales. Montevideo, Uruguay.
2
Universidad de la República, Facultad de Veterinaria, Unidad Académica de Genética y Mejora Animal. Montevideo, Uruguay.
*Correspondence author: oncologiafvetudelar@gmail.com
Polymorphisms in the intron 9-10/exon 10 region of the BRCA1 gene in Canines / Decuadro et al.________________________________
2 of 6 3 of 6
INTRODUCTION
Cancer stands as the leading cause of death in dogs, being
responsible for 27–30% of deaths, and reaching 50% in certain breeds,
such as the Golden Retriever and the Bernese Mountain Dog [1, 2].
In recognition of the importance of cancer research in companion
animals, the National Cancer Institute established the Comparative
Oncology Program in 2003. This initiative has facilitated numerous
studies that have beneted human medicine [3].
Dogs develop spontaneous mammary tumors with clinical and
molecular similarities to human breast cancer. In addition to the
spontaneous presentation of the tumor, there are several clinical
parallels between human breast cancer (HBC) and canine mammary
tumors (CMT). These include age of onset (from 6 years in dogs and
40 years in women), hormonal etiology, disease progression, tumor
size, stage, and invasion of regional lymph nodes. In situ ductal
carcinomas in both human and canine mammary glands exhibit
analogous pathological and molecular characteristics. The traits of
CMT and their resemblances to HBC indicate that dogs could serve
as models for studying the disease in humans [4].
Genetic components and hereditary risk factors for breast cancer
are shared between humans and dogs. One notable example is
the BRCA1 tumor suppressor gene. Mutations in this gene have
been linked to an increased likelihood of developing breast and
ovarian cancer in women due to the accumulation of DNA damage
[5]. BRCA1 has also been identied as a contributing factor in the
development of mammary tumors in certain breeds, including
the English Springer Spaniel [4, 5] Mutations in the BRCA1 tumor
suppressor gene have been linked to a higher risk of mammary
cancer in both humans and canines [6, 7]. In canines, this gene is
located on chromosome CFA9, encompassing 23 exons and four
transcripts (splice variants). In our country, Decuadro et al. (2022)
[8], studied the smaller exons (exons 22 and 23) of the BRCA1 gene
through DNA sequencing, and found no signicant differences in
the molecular markers identied in a group of dogs with mammary
tumors compared to the control group. Furthermore, exon 10 (3444
bp in transcript 202) is the largest exon of this gene in canines and
corresponds, by sequence homology, to exon 11, the largest exon
of the homologous gene in humans [9].
In the Ensembl Dog database (ROS_Cfam_1.0), two SNP–type
polymorphisms are described in the intron 9–10/exon10 initiation
region: SNP1 (missense) (R, G/A) c.715G>A, at protein position
Gly239Ser 239 (aa change G/S) and SNP2 (synonymous variant)
(W, A/T) c.738T>A, at protein position Thr246= 246 (aa T/T) [10].
The interest has focused on SNP1 as it produces a nonsynonymous
change, and its effect on the coding protein remains unknown.
In humans, extensive evidence shows that various types of
mutations (SNPs, InDels, and rearrangements in intron and exon
splicing) ultimately affect the functionality of the encoded protein,
thereby preventing DNA repair [4]. Over time, the progressive
accumulation of DNA damage increases the likelihood of developing
mammary tumors [5]. Since the cloning of BRCA1 in 1994, it has
been observed that it undergoes high alternative splicing, with
more than 100 transcripts detected in humans via next–generation
sequencing (NGS) [11].
The BRCA1 gene encodes a protein that is homologous to the
breast cancer type 1 susceptibility protein (Brc–1). This protein
plays a crucial role in DNA repair and cell cycle regulation in the
mammary gland [12].
Phylogenetically, BRCA1 is an ancient gene, the precise origin of
which remains uncertain. However, evidence suggests a common
ancestor may have emerged approximately 1.6 billion years ago,
at the time of the divergence of animals and plants. [13].
This study aimed to investigate population–level and
evolutionary polymorphisms located in a splicing region of the
largest exon of the BRCA1 gene, with a specic focus on SNP1
and its impact on the amino acid change in the encoded protein
in a population of female dogs with diverse histological types of
mammary tumors.
The aim of this work was to compare the analysis of BRCA1
gene sequence in a group of canines with and without mammary
tumors. Since there are few studies in female dogs that study
breast cancer at a molecular level. The study proposed in this
work will collaborate in obtaining this knowledge in order to have
more elements when facing these clinical cases.
MATERIALS AND METHODS
This study was conducted at the Veterinary Hospital and the
Laboratory of the Genetics and Animal Improvement Unit of the
Faculty of Veterinary Medicine at the University of the Republic
(Montevideo, Uruguay). The study was approved by the Ethics and
Animal Use Committee (CEUA) under the number 1383.
CMT cases were selected based on the presence of nodules
or tumors in the mammary region with clinical characteristics
consistent with those observed in mammary tumors. Fifteen female
dogs. aged 6 to 12 years, were selected, as this is a prime age for
this pathology. Pre–surgical studies, including blood chemistry,
chest X–rays, and urine analysis.
The Clinical Analysis Laboratory has the necessary instruments
for blood tests (CB 31 Oi Biotecnica Instruments S.p.A.).
Thoracic radiographs were obtained in a Vetter Rems 100 device
(Argentina) and digitalized in a Kodak DirectView, Sistem Classic
CR Caresream (Japan) and a TOSHIBA Nemio MX.(Japan) xed
hospital ultrasound scanner.
As well as disease staging according to WHO standards enabled
the implementation of appropriate surgical techniques, with
anesthetic risk classied as ASA I or II. Sedation was performed
with acepromazine 0.05 mg·kg
-1
and morphine 0.5 mg·kg
-1
intramuscularly, anesthesia was induced with propofol 5 mg·kg
-1
intravenously for placement of the tracheotube and inhalational
anesthesia was maintained with isoflurane.
Post–surgery tissue samples were sent for histopathological
study with an Olympus BX51 microscope using hematoxylin and
eosin staining at 40× and 10× magnication
Tumors were grouped according to the histopathological
classication of Goldschmidt et al. (2011) [14] (TABLE I).
Polymorphisms in the intron 9-10/exon 10 region of the BRCA1 gene in Canines / Decuadro et al.________________________________
_________________________________________________________________________________________________Revista Cientica, FCV-LUZ / Vol.XXXV
3 of 6
The control group consisted of fourteen female dogs, within the
same age range and with no oncological pathologies. These dogs,
admitted to the Veterinary Faculty Hospital for other reasons. To
dismiss any oncological pathology all dogs underwent clinical
examination and collateral studies. Blood samples were collected
to perform laboratory analysis (as with dogs with breast tumors),
abdominal ultrasound and thorax radiography. An aliquot of the
blood sample preserved with EDTA was reserved for genetic analysis.
DNA Molecular Studies
Peripheral blood samples were collected from selected animals
under aseptic conditions in accordance with animal welfare
protocols. Blood samples were obtained (3 mL) from the cephalic
vein with a 21 G butterfly by the veterinary nurse. DNA extraction
was conducted using the Quick_DNA
TM
Miniprep Plus Kit (Zymo
Research). DNA samples were quantied using a NanoDrop ND
1000 spectrophotometer, (Thermo Fisher Scientic, USA) with
full spectrum (220–750 nm).
A 281 bp fragment corresponding to the intron 9–10/exon
10 region of the BRCA1 gene (ENSCAFE00845051080) was
amplified by endpoint PCR using a Multigene II machine
(Labnet International, Inc., USA). The following primers were
utilized: F 5’→3’ AGGTGCTTATTTCCACTCCCC and R 5’→3’
TCATGCTGTAATGAGCTGGCA. Amplication conditions comprised
an initial denaturation at 95°C for 5 min, followed by 35 cycles of 1)
denaturation at 95°C for 30 s, 2) annealing at 56°C for 30 s, and 3)
extension at 72°C for 30 s, with a nal extension at 72°C for 5 min.
In each experiment, as analytical quality control a non–
template PCR control tube was added using sterile deionizad
water (negative PCR)
PCR results were conrmed by electrophoresis on 1% agarose
gels in 1× TBE buffer. Electrophoresis was conducted using an
HU13 MIDI horizontal gel electrophoresis system (Scie–plas, Great
Britain) and a POWER PAC 3000 power supply (Bio–Rad, USA). The
resulting bands were visualized under UV light using a BIOSENS
SC805–BIOTOP instrument (Shanghai Bio–Tech Co., Ltd., China).
PCR products (F and R chains) were submitted to Sanger
sequencing on an ABI 3500 instrument (Thermosher, USA)
at GENEXA, Uruguay, to study the polymorphisms identied in
this region. Before the sequencing process, the PCR products
are purified using the Quiagen column kit, in order to obtain
good quality in the sequencing process (elimination of dNTSs,
oligonucleotides, by–products).
Statistical and in silico analysis
The free Bioedit software [15] was used to align 29 sequences
in order to identify SNP polymorphisms in the amplied fragment
and to compare them with the reference canine genome sequence
(Ensembl Dog, ROS_Cfam_1.0)
Genetic variability calculations, Chi–square test for allelic frequencies
of polymorphisms and Hardy–Weinberg Equilibrium (HWE) were
performed using the free POPGENE software version 1.32 [16].
To investigate the impact of SNP1’s amino acid change effect on
the brc1 protein, two online bioinformatics tools were employed:
a) SIFT Sorting Intolerant From Tolerant, [https://sift.bii.a–star.edu.
sg/] [17], and b) PolyPhen–2 (Polymorphism Phenotyping v2) [18].
A sequence alignment and genetic distance Neighbor–Joining tree
of the amplied sequence with available genomic data from Canidae
species was constructed using the online BLAST algorithm (Basic
Local Alignment Search Tool) [19, 20]. Furthermore, reference
population data for 216 canine genotypes reported for SNP1 (204
homozygotes G/G, 10 heterozygotes G/A, and 2 homozygotes A/A)
were downloaded from Ensembl Dog, ROS_Cfam_1.0, for the
purpose of performing a comparative allele frequency and HWE
analysis with the two aforementioned populations.
RESULTS AND DISCUSSION
The presence of the biallelic polymorphism SNP1 was
identied in both populations of female canines (CMT group and
C group) through the use of PCR–sequencing and subsequent
sequence alignment. In the CMT group, two females exhibited
the heterozygous genotype GA, while the remaining 13 were
TABLE I
Description of patients, clinical staging (according to the
WHO), histopathological diagnostic and classication
Case
Age
(years)
Breed Stage
Histopathological
Grade
Histopathology
1 6
Poodle I II Mixed Carcinoma
2 8 Rottweiler III III
Simple Tubular
Carcinoma
3 12
American
Staordshire
Terrier
III III
Tubulopapillary
Carcinoma
4 6 Cocker III II
Simple Tubular
Carcinoma
5 10 Mixed Breed II Benign Complex Adenoma
6 12 Mixed Breed V III
Poorly Dierentiated
Complex Carcinoma
7 10 Cimarrón III III
Anaplastic
Carcinoma
8 8 Cocker I III Solid Carcinoma
10 12 Cimarrón III II
Tubulopapillary
Carcinoma
11 6 Poodle I Benign
Complex Adenoma
with Intraductal
Lobular Hyperplasia
12 12 Poodle I Benign Benign Mixed Tumor
13 12 Cimarrón III II
Tubulopapillary
Carcinoma
14 12 Boxer II II Complex Carcinoma
15 11
Pitbull I Benign Complex Adenoma
Polymorphisms in the intron 9-10/exon 10 region of the BRCA1 gene in Canines / Decuadro et al.________________________________
4 of 6 5 of 6
GG homozygous. In the C group, three females exhibited the
heterozygous genotype GA, while the remaining 11 were GG
homozygous. The homozygous AA genotype for the mutant allele
was not observed in either group (FIG. 1). No statistically signicant
differences were observed between the genotype frequencies in
both populations (Chi–square 0.33, P>0.5), indicating that SNP1
is not linked to mammary tumors in the studied animals. Both
populations were in HWE, whereas the reference population
was not (TABLE II). This deviation from HWE in the reference
population may be attributed to the lack of knowledge regarding
the genotyping method employed, as Iniesta et al, 2005 [21] have
indicated that such a method can introduce biases in interpreting
genotype results. Additionally, the authors have proposed the
biological possibility of inbreeding in the population or selection
for a specic allele. With regard to SNP2 (synonymous variant, W,
A/T) c.738T>A), the mutation was not identied in the studied
groups (CMT and control), exhibiting monomorphic characteristics.
Although this SNP2 is described in the Ensembl database,, there
are no genotyping data in reference populations. Di Giacomo
et al. (2022) [22], using an AmpliSeq panel for BRCA1 variant
identication in a population sample of 22 dogs, identied 12 SNPs
(10 with nonsynonymous changes). These authors identied two
SNPs in exon 10 that differed from the one identied in this work.
Phylogenetically, the amplied sequence demonstrated greater
homology with Canis lupus dingo and Canis lupus familiaris
indicating an evolutionary divergence from the genus Vulpes and
Nyctereutes as expected (FIG. 2). Recent taxonomic revisions
propose that the dingo should be classied as Canis familiaris,
which is the appropriate taxonomic designation for ancient, modern
dog breeds and their hybrids [23].
With regard to the impact of the amino acid substitution resulting
from SNP1 on the brc1 protein (Gly/Ser at position 239), the SIFT
analysis returned a score of 0.08 (indicating a tolerated amino acid
substitution), whereas substitutions with scores < 0.05 are regarded
as “detrimental,” signifying a potential alteration in protein function.
Similarly, PolyPhen–2 analysis classied the substitution as benign
with a score of 0.007 (sensitivity 0.96, specicity 0.75). In this
program, values closer to 1 are predicted with higher condence
to be detrimental (in contrast to the SIFT scale).
In primates, there is evidence that BRCA1 evolves through
positive selection, whereby mutations confer resistance
advantages to viral infections. This could explain its evolution
and the transmission of cancer–related mutations [24].
This study conrmed that the splice initiation region of the
largest exon of BRCA1 in canines, despite presenting SNP–type
polymorphisms, does not affect the functionality of the coding
protein and is not associated with tumors in female canines.
CONCLUSIONS
It has been demonstrated that distinct mutations in the BRCA1
gene are associated with mammary tumors in female canines.
In this study, no statistically signicant relationship was found
between the SNP1 marker and mammary tumors in the problem
and control groups. Furthermore, the amino acid substitution
resulting from this mutation is regarded as being benign to the
brc–1 protein. From a phylogenetic perspective, the amplied
intron 9–10/exon 10 sequence demonstrated homology with
Canis lupus familiaris and a more distant relationship with other
TABLE II
Allelic Frequencies: Observed allelic frequencies of
SNP1 and Chi–square (X
2
) results for HWE
Exon 10–SNP1 c.715G>A
Allelic Frequencies
and X
2
for HWE
With tumors
(CMT)
No tumors
(C)
Reference
Population
Allele G
0,933 0,893 0,968
Allele A 0,067 0,107 0,031
X
2
and P (HWE)
0.0765
P≥0.70 0,202 P≥0.50 16.03 P<0.001
FIGURE 1. Partial multiple alignment of the amplified intron 9–10/exon 10
sequence of the BRCA1 gene from 15 female canines with tumors (T1–T15) and
control females (C1–C14). The REF sample corresponds to the reference sequence
ENSCAFG00845006070 from Ensembl (Canis Lupus familiaris). At position 27021,
the SNP1 polymorphism (letter R, in violet) is observed
FIGURE 2 Neighbor–joining genetic distance tree, generated using the amplied
sequence with the tBlastn multiple alignment program within the Canidae family
.
The consensus sequence amplied in this study is represented by the blue circle
Polymorphisms in the intron 9-10/exon 10 region of the BRCA1 gene in Canines / Decuadro et al.________________________________
_________________________________________________________________________________________________Revista Cientica, FCV-LUZ / Vol.XXXV
5 of 6
genera, such as Vulpes and Nyctereutes, within the Canidae family.
Consequently, it can be concluded that mutations in this splicing
region of the largest exon of BRCA1 are not associated with the
occurrence of mammary tumors in this group of animals.
This is the beginning of a line research at DNA in female dogs
with mammary tumors, and the next step to deepen this work can
be achieved by increasing samples number.
During the course of this work, two sample banks were created,
one of blood and the other of DNA from female dogs with mammary
tumors. These samples will be use in future studies. We also intend
to study other gene sequences and their variants in a larger number
of animals. Likewise, we hope to include the study of epigenetics in
female dogs with mammary tumors compared to healthy animals
in the future.
ACKNOWLEDGMENTS
This work was conducted in the Small Animal Clinic and Surgery
Unit and the Academic Unit of Genetics and Animal Improvement
at the Faculty of Veterinary Medicine, University of the Republic,
with funding from the Sectoral Commission for Scientic Research
(CSIC), the Research and Scientic Development Commission
of the Faculty of Veterinary Medicine (CIDEC), and the Graduate
Academic Programs of the Faculty of Veterinary Medicine, Uruguay.
Conflict of Interest
The authors declared that there is no conflict of interest.
BIBLIOGRAPHIC REFERENCES
[1] Adams V, Evans K, Sampson J, Wood J. Methods and mortality
results of a health survey of purebred dogs in the UK. JSAP.
[Internet]. 2010; 51(10):512–524. doi: https://doi.org/b53qs2
[2] Fleming J, Creevy K, Promislow D. Mortality in North American
dogs from 1984 to 2004: An investigation into age–, size–, and
breed–related causes of death. J. Vet. Intern. Med. [Internet].
2011; 25(2):187–198. doi: https://doi.org/dxs8c2
[3] Paoloni M, Khanna C. Translation of new cancer treatments
from pet dogs to humans. Nat. Rev. Cancer. [Internet]. 2008;
8(2):147–156. doi: https://doi.org/fvrsv4
[4] Abdelmegeed SM, Mohammed S. Canine mammary tumors as
a model for human disease (Review). Oncol. Lett. [Internet].
2018; 15(6):8195–8205. doi: https://doi.org/mdsg
[5] Rivera P, Melin M, Biagi T, Fall T, Häggström J, Lindblad–
Toh, von Euler H. Mammary tumor development in dogs is
associated with BRCA1 and BRCA2. Cancer Res. [Internet].
2009; 69(22):8770–8774. doi: https://doi.org/bz3p2n
[6] Rivera P, von Euler H. Molecular biological aspects on canine
and human mammary tumors. Vet. Pathol. [Internet] 2011;
48(1):132–146. doi: https://doi.org/dp5qh5
[7] Scully R, LIvingston DM. In search of the tumor–suppressor
functions of BRCA1 and BRCA2. Nature [Internet]. 2000;
408:429–432. doi: https://doi.org/cwz6kh
[8] Decuadro A, Llambi S, Benech A, Gagliardi R. Analysis of
polymorphisms in BRCA1 and BRCA2 genes in a population
samples of canines from Uruguay. Rev. Cienti. FCV–LUZ.
[Internet] 2022; 32:e32163. doi https://doi.org/nzt2
[9] Priyam A, Woodcroft BJ, Rai V, Moghul I, Munagala A, Ter F,
Chowdhary H., Pieniak I, Maynard LJ, Gibbins MA, Moon HK,
Davis–Richardson A, Uludag M, Watson–Haigh NS, Challis R,
Nakamura H, Favreau E, Gómez EA, Pluskal T, Leonard G, Rumpf
W, Wurm, Y. Sequenceserver: A modern graphical user interface
for custom BLAST databases. Mol. Biol. Evol. [Internet]. 2019;
36(12):2922–2924. doi: https://doi.org/dgds
[10] Martin FJ, Gall A, Szpak M, Flicek P. Accessing livestock
resources in Ensembl. Front. Genet. [Internet]. 2021;
12:650228. doi: https://doi.org/g8xrxx
[11] Li D, Harlan–Williams LM, Kumaraswamy E, Jensen RA.
BRCA1—No matter how you splice it. Cancer Res. [Internet].
2019; 79(9):2091–2098. doi: https://doi.org/g8xrxz
[12] Ribeiro–Silva A, Garcia SB, Chahud F, Zucoloto S. Impacto
prognóstico da expressão imuno–histoquímica do BRCA1
nos carcinomas mamários esporadicos. [Prognostic impact
of BRCA1 immunohistochemistry expression in sporadic
breast carcinomas]. J. Bras. Patol. Med. Lab. [Internet]. 2005;
41(3):197–203. Portuguese. doi: https://doi.org/bz838s
[13] Pfeffer CM, Ho BN, Singh ATK. The evolution, functions and
applications of the breast cancer genes BRCA1 and BRCA2. CGP.
[Internet]. 2017; 14(5):293–298. doi: https://doi.org/gpdkxj
[14] Goldschmidt M, Peña L, Rasotto R, Zapulli V. Classication and
grading of canine mammary tumors. Vet. Pathol. [Internet]
2011; 48(1):117–131. doi: https://doi.org/cg36bk
[15] Hall TA. BioEdit: a user–friendly biological sequence alignment
editor and analysis program for Windows 95/98/NT. Nucleic.
Acids Symp. Ser. 1999 [cited 21 Aug. 2024]; 41(41):95–98.
Available in: https://goo.su/5Siuf
[16] Yeh F, Yang RC, Boyle TJ, Ye ZH, Mao JX. PopGene, the user–
friendly shareware for population genetic análisis [Internet].
Alberta (Canada): University of Alberta, Molecular Biology and
Biotechnology Center. 1999 [cited 21 Aug. 2024]. Available
in: https://goo.su/YmV1m
[17] Sim NL, Kumar P, Hu J, Henikoff S, Schneider G, Ng PC. SIFT
web server: predicting effects of amino acid substitutions on
proteins. Nucleic Acids Res. [Internet]. 2012; 40(W1):W452–
W457. doi: https://doi.org/gfwv5k
[18] Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova
A, Bork P, Kondrashov AS, Sunyaev SR. A method and server
for predicting damaging missense mutations. Nat. Methods.
[Internet]. 2010; 7(4):248–249. doi: https://doi.org/cc4rrw
[19] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic
local alignment search tool. J. Mol. Biol. [Internet]. 1990;
215:403–410. doi: https://doi.org/cnsjsz
[20] Boratyn GM, Camacho C, Cooper PS, Coulouris G, Fong A, Ma
N, Madden TL, Matten WT, McGinnis SD, Merezhuk Y, Raytselis
Y, Sayers EW, Tao T, Ye J, Zaretskaya I. BLAST: a more efcient
report with usability improvements. Nucleic Acids Res. [Internet].
2013; 41(W1):W29–W33. doi: https://doi.org/gpmk7d
Polymorphisms in the intron 9-10/exon 10 region of the BRCA1 gene in Canines / Decuadro et al.________________________________
6 of 6 MT of 1
[21] Iniesta R, Guinó E, Moreno V. Análisis estadístico de
polimorsmos genéticos en estudios epidemiológicos. Gac.
Sanit. 2005 [cited 24 August 2024]; 19(4):333–341.Available
in: https://goo.su/xNsDbXs
[22] Di Giacomo, D.; Di Domenico, M.; Defourny, SVP.; Malatesta
D, Di Teodoro G, Martino M, Viola A, D’Alterio N, Cammà C,
Modesto P, Petrini A. Validation of AmpliSeq NGS panel for
BRCA1 and BRCA2 variant detection in canine formalin–xed
parafn–embedded mammary tumors. Life [Internet]. 2022,
12(6):851. doi: https://doi.org/g8xrx2
[23] Jackson S, Fleming P, Eldridge M, Archer M, Ingleby S, Johnson
R, Helgen K. Taxonomy of the Dingo: It’s an ancient dog. Aust.
Zool. [Internet]. 2021; 41(3):347–357. doi: https://doi.org/g8xrx3
[24] Lou DI, McBee RM, Le UQ, Stone AC, Wilkerson GK, Demogines
AM, Sawyer SL. Rapid evolution of BRCA1 and BRCA2 in
humans and other primates. BMC Evol. Biol. [Internet]. 2014;
14:155. doi: https://doi.org/f59tsh
