https://doi.org/10.52973/rcfcv-e34416
1 of 5
Revista Científica, FCV-LUZ / Vol. XXXIV, rcfcv-e34416
Received: 08/03/2024 Accepted: 22/04/2024 Published: 16/07/2024
ABSTRACT
Porcine reproductive and respiratory syndrome (PRRS) is a viral
disease that affects pigs, causing signicant economic losses in the
global swine industry due to reproductive and respiratory problems.
The causative agent of PRRS is the PRRS virus (PRRSV), primarily
transmitted through direct or indirect contact via respiratory or oral
routes. Despite biosecurity measures, monitoring, and vaccination,
there is currently no fully effective vaccine against this virus.
Research has identied a quantitative trait locus on chromosome
4 associated with PRRSV resistance. This locus includes genetic
polymorphisms rs80800372 (WUR) and rs340943904 in the GBP1
and GBP5 genes, respectively. PRRSV has been detected in South
America, including Uruguay in 2017. In Uruguay, the Pampa Rocha
pig is the only breed of Creole pigs and is at risk due to its small
population. In this context, the objective was assessing genetic
variability in the Pampa Rocha breed for relevant variables related
to PRRS resistance. The study determined the genotype for these
variants using the end–point PCR technique, followed by Sanger
sequencing. In the study, corresponding alleles were identied for
each variable of interest, with allele frequencies of 0.825 for the A
allele and 0.175 for the G allele in rs80800372 (WUR), and 0.825 for
the G allele and 0.175 for the T allele in rs340943904. The variants are
in Hardy Weinberg equilibrium and there is a linkage disequilibrium
between them. The study highlights an increase in the frequency of
favorable alleles related to PRRSV resistance in Pampa Rocha creole
pigs. These ndings underscore the importance of using molecular
markers to identify PRRS–resistant animals, which could be benecial
for both pig production and animal welfare.
Key words: genetic resistance; creole pigs, PRRS
RESUMEN
El síndrome reproductivo y respiratorio porcino (PRRS) es una
enfermedad viral que afecta a cerdos, provocando problemas
reproductivos y respiratorios que causan pérdidas económicas
signicativas en la industria porcina mundial. El virus PRRSV es el
agente responsable, transmitido principalmente por contacto directo
o indirecto a través de vías respiratorias u orales. Aunque el control de
este virus implica medidas de bioseguridad, monitoreo y vacunación, no
existe actualmente una vacuna totalmente ecaz. Investigaciones han
identicado un locus de rasgo cuantitativo en el cromosoma 4 asociado
con la resistencia al PRRSV, que incluye a los polimorsmos rs80800372
(WUR) y rs340943904 en los genes GBP1 y GBP5 respectivamente. El
PRRSV ha sido detectado en América del Sur, incluido Uruguay en el
año 2017. En Uruguay, los cerdos Pampa Rocha son la única raza de
cerdos criollos y se encuentran en riesgo debido a su baja población. En
este contexto, se plantea evaluar la variabilidad genética en esta raza
para las variables de interés, relacionadas con la resistencia al PRRS.
Para determinar los genotipos se utilizó la técnica de PCR en tiempo
nal, seguida de secuenciación Sanger. Se identicaron los alelos
correspondientes para cada variable, con frecuencias de 0,825 para
el alelo A y 0,175 para el alelo G en rs80800372 (WUR), y de 0,825 para
el alelo G y 0,175 para el alelo T en rs340943904. Ambas variantes se
encuentran en equilibrio de Hardy Weinberg y presentan desequilibrio
de ligamiento. El estudio destaca un aumento en la frecuencia de
los alelos favorables en los genes GBP1 y GBP5 relacionados con la
resistencia al PRRSV, en los cerdos Pampa Rocha. Estos hallazgos
subrayan la importancia de utilizar marcadores moleculares para
identicar animales resistentes al PRRS, lo cual podría ser benecioso
para la producción porcina y el bienestar animal.
Palabras clave: resistencia genética; cerdos criollos, PRRS
Identication of variants in GBP1 and GBP5 Genes associated with
susceptibility and resistance to porcine reproductive and respiratory
syndrome in Uruguayan Creole pigs
Identicación de variantes en los genes GBP1 y GBP5 asociados a resistencia y susceptibilidad
al síndrome reproductivo y respiratorio porcino en cerdos criollos de Uruguay
María del Carmen Montenegro
1
* , Nariné Balemian
1
, Bibiana Freire
2
, Cecilia Carballo
3
, Silvia Llambí
1
1
Universidad de la República, Facultad de Veterinaria, Unidad Académica de Genética y Mejora Animal. Montevideo, Uruguay.
2
Universidad de la República, Facultad de Veterinaria, Unidad Académica de Animales de Granja. Montevideo, Uruguay.
3
Universidad de la República, Facultad de Agronomía, Unidad de Producción de Cerdos. Montevideo, Uruguay.
*Corresponding author: mariadc.montenegro@gmail.com
Variants in GBP1 and GBP5 associated with PRRS resistance in Uruguayan Creole pigs / Montenegro et al. ________________________
2 of 5
INTRODUCTION
The porcine reproductive and respiratory syndrome (PRRS) is a
viral disease that causes reproductive and respiratory complications
in pigs (Sus scrofa ferus), signicantly impacting animal welfare and
resulting in considerable economic losses globally within the swine
industry. Reproductive consequences include spontaneous abortions
in females, premature births, and a decline in the quality of semen
from boars. Meanwhile, respiratory issues reduce the growth rate of
pigs throughout the fattening stage [1, 2].
The causative agent of this disease is the PRRS virus (PRRSV),
which is a single–stranded positive–sense RNA virus belonging to
the Betaarterivirus genus and the Arteriviridae family. This virus is
classied into two genotypes: PRRSV–1 (European) and PRRSV–2
(North American) [3, 4].
Transmission of PRRSV can occur through direct or indirect
contact, primarily via respiratory or oral routes, penetrating mucous
membranes or even percutaneously. The virus can be transmitted
airborne, during mating or insemination, through ingestion, contact, or
inoculation [5]. During gestation, the virus has the ability to cross the
placental barrier and infect embryos, potentially leading to the most
severe clinical manifestation of the disease at the end of gestation.
This is characterized by abortions, premature births, mummication,
and the birth of weak and congenitally infected piglets, leading to
high mortality before weaning [6].
PRRSV control involves several key aspects, including early
diagnosis, continuous monitoring, implementation of biosecurity
measures, and proper herd management and vaccination [5].
Currently, there is no fully effective vaccine against PRRSV due to
the virus’s genetic and antigenic variations, as well as its ability to
evade the host immune response. Therefore, it is crucial to explore
alternative control strategies, with genetic improvement of pigs
being one option [7, 8]. In this regard, different pig breeds exhibit
varying levels of resistance to PRRSV, emphasizing the importance
of studying genetic factors to enhance pig resistance to this disease.
Such efforts would contribute to animal welfare and mitigate the
associated economic losses [4, 9].
Through genome–wide association studies, a quantitative trait
locus (QTL) has been identied on chromosome 4 (SSC4), associated
with host resistance to PRRSV, weight gain, and viral load [10]. Within
the single nucleotide polymorphisms (SNPs) identied in this region,
rs80800372 (known as WUR) occurs in the GBP1 gene, and rs340943904
in the GBP5 gene [11, 12]. Since the identication of this QTL, the
effect of the WUR variant has been associated with increased weight
and viral load following PRRS infection [10]. Additionally, it has been
linked to the host response to PRRSV infection, PRRS vaccination, and
coinfection with PRRSV and porcine circovirus type 2b [13]. Subsequent
research by Koltes et al. [12] revealed that the candidate gene is the
one encoding guanylate–binding protein 5 (GBP5), located in the region
surrounding WUR.
The rs80800372 variant in GBP1 corresponds to an A/G mutation in
the 3’ untranslated region (3’UTR), with G being the favorable allele,
while rs340943904 in GBP5 is a G/T variant at a splice site, with the
T allele being favorable [14].
PRRS was rst identied in the late 1980s in North America and
Europe [15]. In South America, PRRSV has been reported in Bolivia,
Chile, Colombia, Peru, Venezuela, Ecuador and Uruguay [16]. In Uruguay,
the rst detection of the virus was carried out by Ramos et al. [17],
identifying the circulation of PRRSV type 2. This study included a
retrospective serological analysis suggesting that the virus may have
been present in the country since 2011.
Pig production in Uruguay, while economically less signicant,
plays a crucial role in supporting low–income producers [18]. In this
context, local zoogenetic resources become more important due
to their better adaptation to local conditions and their production
capacity with lower requirements. These animals are commonly
utilized in small–scale traditional subsistence systems, playing a
fundamental role in ensuring food security [19]. In Uruguay, the Pampa
Rocha breed represents the only creole pig breed [20]. These pigs
stand out for the qualities of their females, including characteristics
such as prolicacy, ability to consume pastures, milk production, and
productive longevity [21]. However, the current number of animals of
this breed is unknown, posing a risk to their conservation.
To date, no studies have been conducted in Uruguay evaluating the
genetic resistance/susceptibility to PRRSV in Pampa Rocha creole
pigs. Based on this gap, the objective is to determine the genotypes
for the variants rs80800372 (in GBP1) and rs340943904 (in GBP5)
in this local pig breed in Uruguay. This preliminary investigation is
relevant for enhancing the understanding of the genetic variability
present in Pampa Rocha pigs and contributing to their conservation.
MATERIALS AND METHODS
Twenty DNA samples from pigs were utilized in this study, including
14 Pampa Rocha, three Pampa Rocha–Duroc hybrids, one Large White,
one Duroc, and one Pietrain. These samples are part of the DNA bank
at the Academic Unit of Animal Genetics and Improvement within
the Faculty of Veterinary Medicine at the University of the Republic
(Udelar) in Montevideo, Uruguay. These animals come from a rescue
center for the conservation of the breed.
Genotypes were determined using the end–point PCR technique,
followed by Sanger sequencing [22]. Specic primers were designed
using the Primer BLAST tool [23].
Amplication was performed using a Multigene II equipment (Labnet
International, Inc. USA). TABLE I provides details of the primers used and
the amplication conditions for the regions containing both variants.
The amplification results were analyzed using agarose gel
electrophoresis (1% agarose gel stained with Goodview Nucleic Acid
Stain) in 1× TBE buffer. Electrophoresis was conducted using an HU13
MIDI Horizontal Gel electrophoresis system (Scie–plas, Great Britain)
and a POWER PAC 3000 power supply (Bio–Rad, USA). The resulting
bands were visualized under UV light using a BIOSENS SC805–BIOTOP
instrument (Shanghai Bio–Tech Co. Ltd. China). Amplicon sequencing
was performed in a sequencer ABI 3500 (Thermosher, USA) by the
company Genexa (Montevideo, Uruguay). Sequence analysis and
determination of genotypes for the studied variants were carried
out through alignment using the BioEdit program [24]. Reference
sequences for porcine GBP1 and GBP5 genes were retrieved from the
Ensembl database (ensembl.org). Allelic and genotypic frequencies, as
well as the calculation of Fis values according to Weir and Cockerham
[25], were determined using the GENETIX V 4.05 program [26]. The
Hardy–Weinberg exact test was performed for each locus using the
Genepop version 4.7.5 web tool [27, 28]. Finally, linkage disequilibrium
between the variants was determined according to Black and Krafsur
[29] in the GENETIX V 4.05 program [26].
TABLE I
Analyzed variants and amplication conditions
Variant Gene Primers Amplication conditions Amplicon size
rs80800372 (WUR10000125)
GBP1
F: GGAATGCGCGATGCTTACTG
R: TGTAAATTGCCGCAAACGCC
Initial denaturation: 95°C, 5 min
35 cycles of:
1. Denaturation at 95°C for 30 s.
2. Annealing at 56°C for 30 s.
3. Extension at 72°C for 30 s.
Final extension at 72°C for 5 min.
276 bp
rs340943904
GBP5
F: GACAGAAACGCTACCCATCGT
R: CCTGCTGGTGCAGTCTGTTT
Initial denaturation: 95°C, 5 min
35 cycles of:
1. Denaturation at 95°C for 30 s.
2. Annealing at 55°C for 30 s.
3. Extension at 72°C for 30 s.
Final extension at 72°C for 5 min.
402 bp
FIGURE 1. Alignments of the analyzed sequences in the GBP1 (a) and GBP5 (b) genes.
Each sample is identied on the left (PR: Pampa Rocha, HDP: Pampa Rocha–Duroc
hybrids, LW: Large White, D: Duroc, P: Pietrain, RefSeq–GBP1: Reference sequence
of GBP1, RefSeq–GBP5: Reference sequence of GBP5). The arrows indicate variants
rs80800372 (a) and rs340943904 (b). The letters A, G and T indicate that the animal’s
genotype is homozygous AA, homozygous GG, and homozygous TT, respectively.
The letter R indicates genotypes AG and the letter K indicates genotypes GT.
_____________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIV, rcfcv-e34416
3 of 5
RESULTS AND DISCUSSION
In the 20 analyzed samples, the regions harboring the variants of
interest were successfully amplied: rs80800372 in the GBP1 gene
and rs340943904 in the GBP5 gene, resulting in fragments of 276
bp and 402 bp, respectively. Subsequently, from the sequencing
of these fragments, the corresponding alleles for each SNP were
identied. For SNP rs80800372 in GBP1, the allele frequencies were
0.825 for allele A and 0.175 for allele G. Regarding SNP rs340943904
in GBP5, the allelic frequencies were 0.825 for allele G and 0.175 for
allele T. Both variants were found to be in Hardy–Weinberg equilibrium
in the studied population sample (P>0.4678 in both cases). When
considering only Pampa Rocha breed animals (N=14), there was an
increase in the frequency of favorable alleles (G for rs80800372 and T
for rs340943904), both rising from 0.175 to 0.215. For SNP rs80800372,
the expected genotypic frequencies were 0.68 for AA, 0.28 for AG,
and 0.03 for GG. These values were repeated for genotypes GG, GT
and TT, respectively, in rs340943904. The Fis values for each locus
were 0.159. FIG. 1 shows the alignments generated using the Bioedit
program [24] for both variants.
Various studies have demonstrated that certain pig breeds
exhibit greater resistance to PRRS. Notably, Chinese breeds such
as Tongcheng and Meishan are known for their elevated resistance to
PRRSV [30, 4]. Additionally, other native Chinese breeds and Tibetan
pigs show differential susceptibility to PRRS infections [31, 32]. In the
case of commercial breeds, it has been observed that Duroc females
generally exhibit greater resilience to PRRS than Landrace sows [33].
To verify the trend observed in this study in Pampa Rocha pigs, the
number of individuals studied should be increased. It is worth noting
that genetic studies in the Pampa Rocha breed have indicated the
inuence of Asian breeds in their origin [34].
Regarding the linkage disequilibrium test, a correlation coecient
of 0.99 was determined, indicating a signicant correlation between
both variants in the analyzed pig sample. This is due to their proximity
on chromosome 4 and explains the similarity in allelic and genotypic
frequencies, as certain allele combinations occur more frequently.
The presence of strong linkage disequilibrium between these SNPs
on SSC4 has been reported in hybrid pigs [14, 35] and Yorkshire
[12], among others. However, Kim et al. [36] did not nd elevated
correlations in Korean pig breeds. This correlation is useful for
conducting genetic association studies, using one of the SNPs as a
marker to identify nearby variants associated with a specic trait,
such as the causative mutation in GBP5. The rs80800372 SNP (WUR),
which is in linkage disequilibrium with the putative causative mutation
in GBP5, can serve as a genetic marker for studying this mutation,
as it is not present in commercial genotyping platforms [13]. GBP5
has been identied by Koltes et al. [12] as a strong candidate gene
for PRRS resistance/susceptibility. This conclusion is based on its
differential expression during PRRSV infection, the presence of splice
variant differences among animals with different genotypes, and its
role in inammasome assembly during the immune response.
In addition to the polymorphisms studied in this work, it would
be of interest to analyze other markers in GBP1 and GBP5, as well
as in other genes such as GBP2, GBP4, GBP6, CCBL2, GTF2B, PKN2,
and CD163, as associations with PRRS infection resistance in pigs
have been reported [9, 35]. It is also important to explore other
factors collectively, such as viral load and weight variations, as host
resistance to PRRSV is estimated through a combination of these
factors [9]. Furthermore, studying gene expression would provide a
more comprehensive understanding of the mechanisms underlying
resistance to this disease.
Variants in GBP1 and GBP5 associated with PRRS resistance in Uruguayan Creole pigs / Montenegro et al. ________________________
4 of 5
Controlling PRRS presents a complex challenge that requires a
combination of diverse measures, given the virus’s high genetic
variability and the limited ecacy of current vaccines [3, 5]. It is
crucial to explore alternative approaches for its management. One
such approach involves identifying resistant individuals through
genotyping of candidate genes across different pig breeds. It is
essential to consider local zoogenetic resources, as these animals
are often better adapted to local production systems, exhibiting
greater hardiness and reduced selection pressure. In the case of the
Pampa Rocha pig, due to the ndings of this study and the inuence
of Asian breeds in its origin (which tend to be more resistant to PRRSV
infections), further research is warranted.
Currently, leveraging the availability of cost–effective genomic
information and advanced genetic selection tools offers opportunities
to enhance resistance and monitor detrimental variants. However,
biosecurity, disease surveillance and vaccination remain essential.
An integrated approach across disciplines is essential for effectively
preventing, controlling, and eradicating diseases like PRRS [7].
Improving understanding of animal resistance to diseases such
as PRRS not only benets production and animal welfare but also
promotes the sustainability of pig farming. This is particularly crucial
when considering local zoogenetic resources and the producers
working with them.
CONCLUSIONS
The results of this study demonstrate the presence of genetic
variants in the GBP1 and GBP5 genes that may be implicated in PRRSV
resistance in Pampa Rocha pigs from Uruguay. An increase in the
frequency of favorable alleles was observed in this population, along
with strong linkage disequilibrium among the studied SNPs. These
ndings suggest the importance of continuing research on these
candidate genes, as well as exploring other genes and factors related
to disease resistance. Conrming the trend found in this work would
further enhance the value of the local Pampa Rocha pig breed. The
use of DNA molecular markers for identifying resistant animals could
be a valuable tool for improving pig production and animal welfare,
with a focus on utilizing local zoogenetic resources.
ACKNOWLEDGMENTS
This study was supported by Universidad de la República (Uruguay).
Conict of interest statement
The authors declare no conict of interest.
BIBLIOGRAPHIC REFERENCES
[1] Abella G, Pena RN, Nogareda C, Armengol R, Vidal A, Moradell L,
Tarancon V, Novell E, Estany J, Fraile L. A WUR SNP is associated
with European Porcine Reproductive and Respiratory Virus
Syndrome resistance and growth performance in pigs. Res. Vet.
Sci. [Internet]. 2016; 104:117–122. doi: https://doi.org/f8bw9v
[2] You X, Li G, Lei Y, Xu Z, Zhang P, Yang Y. Role of genetic factors
in different swine breeds exhibiting varying levels of resistance/
susceptibility to PRRSV. Virus Res. [Internet]. 2023; 326:199057.
doi: https://doi.org/gs642r
[3] Guo C, Liu X. Editorial: Porcine reproductive and respiratory syndrome
virus – animal virology, immunology, and pathogenesis. Front.
Immunol. [Internet]. 2023; 14:1194386. doi: https://doi.org/gtn97d
[4] Pei Y, Lin C, Li H, Feng Z. Genetic background inuences pig responses
to porcine reproductive and respiratory syndrome virus. Front. Vet.
Sci. [Internet]. 2023; 10:1289570. doi: https://doi.org/gs65df
[5] Pileri E, Mateu E. Review on the transmission porcine reproductive
and respiratory syndrome virus between pigs and farms and
impact on vaccination. Vet. Res. [Internet]. 2016; 47:108. doi:
https://doi.org/f89dr6
[6] Pena RN, Fernández C, Blasco–Felip M, Fraile LJ, Estany J. Genetic
Markers Associated with Field PRRSV–Induced Abortion Rates.
Viruses. [Internet]. 2019; 11(8):706. doi: https://doi.org/m7wb
[7] Harlizius B, Mathur P, Knol EF. Breeding for resilience: new
opportunities in a modern pig breeding program. J. Anim. Sci.
[Internet]. 2020; 98(Suppl. 1):S150–S154. doi: https://doi.org/m7wc
[8] Dekkers J, Rowland RRR, Lunney JK, Plastow G. Host genetics
of response to porcine reproductive and respiratory syndrome
in nursery pigs. Vet. Microbiol. [Internet]. 2017; 209:107–113. doi:
https://doi.org/gchvxw
[9] Wu Q, Han Y, Wu X, Wang Y, Su Q, Shen Y, Guan K, Michal JJ, Jiang
Z, Liu B, Zhou X. Integrated time–series transcriptomic and
metabolomic analyses reveal different inammatory and adaptive
immune responses contributing to host resistance to PRRSV. Front.
Immunol. [Internet]. 2022; 13:960709. doi: https://doi.org/gsgtc6
[10] Boddicker N, Waide EH, Rowland RRR, Lunney JK, Garrick DJ,
Reecy JM, Dekkers JCM. Evidence for a major QTL associated
with host response to porcine reproductive and respiratory
syndrome virus challenge. J. Anim. Sci. [Internet]. 2012;
90(6):1733–1746. doi: https://doi.org/fzww9v
[11] Boddicker NJ, Garrick DJ, Rowland RRR, Lunney JK, Reecy JM,
Dekkers JCM. Validation and further characterization of a major
quantitative trait locus associated with host response to experimental
infection with porcine reproductive and respiratory syndrome virus.
Anim. Genet. [Internet]. 2014; 45(1):48–58. doi: https://doi.org/f5nb77
[12] Koltes JE, Fritz–Waters E, Eisley CJ, Choi I, Bao H, Kommadath A,
Serão NVL, Boddicker NJ, Abrams SM, Schroyen M, Loyd H, Tuggle
CK, Plastow GS, Guan L, Stothard P, Lunney JK, Liu P, Carpenter S,
Rowland RRR, Dekkers JCM, Reecy JM. Identication of a putative
quantitative trait nucleotide in guanylate binding protein 5 for
host response to PRRS virus infection. BMC Genomics. [Internet].
2015; 16:412. doi: https://doi.org/f7nkhw
[13] Dunkelberger JR, Serão NVL, Weng Z, Waide EH, Niederwerder
MC, Kerrigan MA, Lunney JK, Rowland RRR, Dekkers JCM. Genomic
regions associated with host response to porcine reproductive and
respiratory syndrome vaccination and co–infection in nursery pigs.
BMC Genomics. [Internet]. 2017; 18:865. doi: https://doi.org/m7wd
[14] Jeon RL, Cheng J, Putz AM, Dong Q, Harding JCS, Dyck MK,
Plastow GS, Fortin F, Lunney J, Rowland R, et al. Effect of a
genetic marker for the GBP5 gene on resilience to a polymicrobial
natural disease challenge in pigs. Livest Sci. [Internet]. 2021;
244 (Suppl. 4):104399–101413. doi: https://doi.org/m7wf
_____________________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIV, rcfcv-e34416
5 of 5
[15] Lunney JK, Beneld DA, Rowland RRR. Porcine reproductive
and respiratory syndrome virus: an update on an emerging and
re–emerging viral disease of swine. Virus Res. [Internet]. 2010;
154(1–2):1–6. doi: https://doi.org/ftw8kf
[16] Ramos N, Betancour G, Puig J, Arbiza J. An update on genetic
analysis of porcine reproductive and respiratory syndrome
virus type 2 (PRRSV–2) in South America: identication of ORF5
sequences of lineage 1A, 1C and 1G. Arch. Microbiol. [Internet].
2022; 204(7):367. doi: https://doi.org/m7wg
[17] Ramos N, Mirazo S, Castro G, Cabrera K, Osorio F, Arbiza J. First–
time detection of porcine reproductive and respiratory syndrome
virus (PRRSV) infection in Uruguay. Transbound. Emerg. Dis.
[Internet]. 2018; 65(2):352–356. doi: https://doi.org/gcvjqg
[18] Castro G. Situación de los recursos genéticos porcinos locales
en Uruguay. Arch. Zootec. [Internet]. 2007 [cited 6 Feb 2024];
56(Supl.1):783–788. Available in: https://goo.su/wwOFN
[19] Food and Agriculture Organization of the United Nations (FAO).
Plan de acción mundial sobre los recursos zoogenéticos y la
Declaración de Interlaken [Internet]. Roma: FAO; 2007 [cited
February 6, 2024]. 52 p. Disponible en: https://goo.su/zkeqY
[20] Barlocco N. Experiencias en la caracterización productiva del
cerdo Pampa Rocha en Uruguay. Producción de carne natural.
En: Llambí S, coordinadora. Situación y conservación de
recursos zoogenéticos porcinos. Montevideo (UY): Ocina de
Publicaciones de Facultad de Veterinaria (Udelar); 2011. p. 31–39.
[21] Vadell A, Barlocco N, Carballo C. Prolicidad y longevidad productiva
de cerdas Pampa Rocha en un sistema de producción al aire libre.
Rev. Computadorizada Prod. Porc. [Internet]. 2010 [cited 14 Feb
2024]; 17(2):149–153. Disponible en: https://goo.su/04Oz0
[22] Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain–
terminating inhibitors. Proc. Natl. Acad. Sci. USA. [Internet].
1977; 74(12):5463–5467. doi: https://doi.org/dgsrk5
[23] Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden
TL. Primer–BLAST: a tool to design target–specic primers for
polymerase chain reaction. BMC Bioinform. [Internet]. 2012;
13:134. doi: https://doi.org/f38qjk
[24] Hall TA. BioEdit: A User–Friendly Biological Sequence Alignment
Editor and Analysis Program for Windows 95/98/NT. Nucleic
Acids Symp. Ser. 1999; 41:95–98.
[25] Weir BS, Cockerham CC. Estimating F–Statistics for the analysis
of population structure. Evolution. [Internet]. 1984; 38(6):1358–
1370. doi: https://doi.org/gg27rg
[26] Belkhir K, Borsa P, Chikhi L, Rafauste N, Bonhomme F. Page
WEB de GENETIX [homepage on the Internet]. Montpellier (FR):
Université de Montpellier II, Institut des Sciences de l’Evolution;
2004 [cited 14 Feb. 2024]. Available in: https://goo.su/DbgsF
[27] Raymond M, Rousset F. GENEPOP (version 1.2): Population
Genetics Software for Exact Tests dnd Ecumenicism. J. Heredity
[Internet]. 1995; 86(3):248–249. doi: https://doi.org/gfkmsg
[28] Rousset F. 2008. GENEPOP’007: A Complete Reimplementation of
the Genepop Software for Windows and Linux. Mol. Ecol. Resour.
[Internet]. 2008; 8(1):103–106. doi: https://doi.org/c38k86
[29] Black WC, Krafsur ES. A FORTRAN Program for the Calculation
and Analysis of Two–locus Linkage Disequilibrium Coecients.
Theor. Appl. Genet. [Internet]. 1985; 70(5):491–496. doi: https://
doi.org/dcmjrk
[30] Liang W, Li Z, Wang P, Fan P, Zhang Y, Zhang Q, Wang Y, Xu X, Liu B.
Differences of immune responses between Tongcheng (Chinese
local breed) and Large White pigs after articial infection with highly
pathogenic porcine reproductive and respiratory syndrome virus.
Virus Res. [Internet]. 2016; 215:84–93. doi: https://doi.org/f8fkdw
[31] Meng C, Su L, Li Y, Zhu Q, Li J, Wang H, He Q, Wang C,Wang W,
Cao S. Different Susceptibility to Porcine Reproductive and
Respiratory Syndrome Virus Infection Among Chinese Native
Pig Breeds. Arch. Virol. [Internet]. 2018; 163(8):2155–2164. doi:
https://doi.org/gd3b6v
[32] Kang R, Ji G, Yang X, Lv X, Zhang Y, Ge M, Pan Y, Li Q, Wang H,
Zeng F. Investigation on Host Susceptibility of Tibetan Pig to
Infection of Porcine Reproductive and Respiratory Syndrome
Virus Through Viral Challenge Study. Vet. Microbiol. [Internet].
2016; 183:62–68. doi: https://doi.org/f79dx3
[33] Hickmann FMW, Braccini Neto J, Kramer LM, Huang Y, Gray
KA, Dekkers JCM, Sanglard LP, Serão NVL. Host Genetics of
Response to Porcine Reproductive and Respiratory Syndrome
in Sows: Reproductive Performance. Front. Genet. [Internet].
2021; 12:707870. doi: https://doi.org/m7wh
[34] Montenegro M, Llambí S, Castro G, Barlocco N, Vadell A, Landi V,
Delgado JV, Martínez A. Genetic Characterization of Uruguayan
Pampa Rocha Pigs with Microsatellite Markers. Genet. Mol. Biol.
[Internet]. 2015; 38(1):48–54. doi: https://doi.org/f67n2g
[35] Khatun A, Nazki S, Jeong CG, Gu S, Mattoo SUS, Lee SI, Yang MS,
Lim B, Kim KS, Kim B, Lee KT, Park CK, Lee SM, Kim WI. Effect of
Polymorphisms in Porcine Guanylate–Binding Proteins on Host
Resistance to PRRSV Infection in Experimentally Challenged
Pigs. Vet. Res. [Internet]. 2020; 51:14. doi: https://doi.org/m7wj
[36] Kim S, Cho ES, Kim YS, Lim Y, Jeong SA, Song M, Lee KT, Kim
JM. Novel Insight into Linkage Disequilibrium and Additive Effect
of GBP1 and GBP5 SNP Haplotypes Associated with Porcine
Reproductive and Respiratory Syndrome Virus Susceptibility in
Korean Native Pigs. Anim. Genet. [Internet]. 2021; 52(6):897–898.
doi: https://doi.org/gpw4nj
