https://doi.org/10.52973/rcfcv-e33254
Received: 31/03/2023 Accepted: 22/05/2023 Published: 08/06/2023
1 of 7
Revista Científica, FCV-LUZ / Vol. XXXIII, rcfcv-e33254, 1 – 7
ABSTRACT
Colon cancer (CRC) is one of the most common types of cancer in
the world. In this study, the effects of Tarantula cubensis alcoholic
extract (TCAE) and the Capecitabine in CRC were investigated. Wistar
albino rats were divided into eight groups with 12 animals in each
group: untreated healthy and CRC groups, healthy and CRC groups
treated with TCAE or Capecitabine, and healthy and CRC groups
treated with both TCAE and Capecitabine. Azoxymethane was used
in all CRC groups. TCAE and Capecitabine were administered to the
relevant groups starting in the 15th week. All rats were euthanized
after 18 weeks, and tissue samples were collected. The mRNA levels
of Bcl–2, Bax, and Cas–3 in the harvested tissues were determined
using real–time PCR and histopathologically abnormal crypt foci
(ACF) scores were determined. It was found that TCAE modulated the
decreased Bax/Bcl–2 expression rate in the CC group, but had the
opposite effect in healthy animals, which was signicantly reduced
compared to the healthy groups (P<0.05). In addition, this rate was
signicantly lower in Capecitabine administered groups compared
to other groups, and a paradoxical effect was observed (P<0.05).
No signicant change was observed in Cas–3 expression levels in
all groups (P>0.05). Importantly, single and combined use of TCAE
and Capecitabine in rats with CRC signicantly reduced ACF scores
(P<0.05). It can be stated that TCAE can specically modulate the
decreased Bax/Bcl–2 ratio in animals with cancer, and the therapeutic
ecacy of Capecitabine is achieved at a dose of 40 mg·kg
-1
.
Key words: Azoxymethane; Capecitabine; colorectal cancer; TCAE
RESUMEN
El cáncer de colon (CRC) es uno de los tipos de cáncer más comunes
en el mundo. En este estudio, se investigaron los efectos del extracto
alcohólico de Tarantula cubensis (TCAE) y la capecitabina en CRC. Las
ratas albinas Wistar se dividieron en ocho grupos con 12 animales
en cada grupo: grupos sanos y CRC sin tratar, grupos sanos y CRC
tratados con TCAE o capecitabina, y grupos sanos y CRC tratados
con TCAE y capecitabina. Se usó azoximetano en todos los grupos de
CRC. Se administraron TCAE y capecitabina a los grupos pertinentes a
partir de la semana 15. Todas las ratas fueron sacricadas después de
18 semanas y se recogieron muestras de tejido. Los niveles de ARNm
de Bcl–2, Bax y Cas–3 en los tejidos recolectados se determinaron
mediante PCR en tiempo real y se determinaron las puntuaciones de
focos de cripta histopatológicamente anormales (ACF). Se encontró
que TCAE moduló la disminución de la tasa de expresión de Bax/
Bcl–2 en el grupo CC, pero tuvo el efecto contrario en animales sanos,
que se redujo signicativamente en comparación con los grupos
sanos (P<0,05). Además, esta tasa fue signicativamente menor
en los grupos a los que se administró capecitabina en comparación
con otros grupos, y se observó un efecto paradójico (P<0,05). No se
observaron cambios signicativos en los niveles de expresión de
Cas–3 en todos los grupos (P>0,05). Es importante destacar que el
uso único y combinado de TCAE y capecitabina en ratas con CCR
redujo signicativamente las puntuaciones de ACF (P<0,05). Se puede
armar que TCAE puede modular especícamente la disminución de
la relación Bax/Bcl–2 en animales con cáncer, y la ecacia terapéutica
de capecitabina se logra a una dosis de 40 mg·kg
-1
.
Palabras clave: Azoximetano; Capecitabina; cáncer colorectal;
TCAE
Effect of Tarantula cubensis alcohol extract and Capecitabin combine in
Colorectal Cancer rats
Efecto de la combinación de extracto de alcohol de Tarántula cubensis y Capecitabina en ratas con
Cáncer Colorrectal
Rahmi Canbar
1
* , Ozgur Ozdemir
2
, Ahmet Levent Bas
3
1
Necmettin Erbakan University, Veterinary Medicine, Department of Pharmacology and Toxicology. Ereğli, Konya, Turkey.
2
Selcuk University, Faculty of Veterinary Medicine, Department of Pathology. Selcuklu, Konya, Turkey.
3
Selcuk University, Veterinary Medicine, Department of Pharmacology and Toxicology. Selcuklu, Konya, Turkey.
*Corresponding Author: rahmicanbar@hotmail.com
Effects of Tarantula cubensis extract and Capecitabine in Colorectal Cancer rats / Canbar et al. __________________________________
2 of 7
INTRODUCTION
The incidence of colorectal cancer (CRC) is the third–highest of
all cancers [1]. CRC is also found in Veterinary Medicine [2]. Unlike
other cancer types, mutations in tumor suppressor genes (TSG)
have been reported in CRC [3]. Moreover, CRC arises due to defects
in oncogenes, TSG, and genes related to deoxyribose nucleic acid
(DNA) repair mechanisms [4]. Capecitabine is a new oral adjuvant
and palliative Fluoropyrimidine prodrug approved by The United
States Food and Drug Agency (FDA) in 1998 that inhibits Thymidylate
synthase [5] and is used to treat various cancer types. It has been
reported that Capecitabine is converted to 5–Fluorouracil (5–FU) when
prepared in oral formulation [6] with a recommended dose of 2,500
mg·m
-2
administered for 14 out of every 21 days [7]. Capecitabine is
converted to the active form after a three–step enzymatic activation
process. The enzyme Cytidine deaminase, which plays a role in the
catabolism of the drug in rats (Rattus norvegicus), is at a lower level
than in monkeys (Cnomolgus monkeys) and humans [8]. In addition,
the enzyme activity and plasma concentrations of its metabolites
have been reported to decrease with repeated applications of
Capecitabine [9]. Fluorodeoxyuridine monophosphate, which is
formed by the enzymatic conversion of 5–FU by Thymidine kinase,
is reported to inhibit Thymidylate synthetase, which is the rate–
limiting step in Thymidine synthesis. In addition, without Thymidine,
desoxi rribonuclec acid (DNA) synthesis is impaired, and cellular death
occurs. 5–FU is also converted to Fluorouridine Triphosphate (FUTP),
the antimetabolite of 5–FU, by Thymidine Phosphorylase (dThdPase),
and FUTP binds to RNA and instructs the cell to undergo apoptosis
[10]. Interestingly the dThdPase enzyme is found at higher levels in
cancerous tissues than in normal tissues, so Capecitabine has a more
effective and safer prole than 5–FU [11].
Tarantula cubensis alcoholic extract (TCAE) is a homeopathic
product used in Veterinary Medicine, where it is generally used to
treat conditions such as gangrene, septicemia, and toxemia [12].
Moreover, it is reported to increase apoptosis in cancer cells in vitro
via the caspase–3 (Cas–3) pathway [13] and to cause clinically positive
effects in caninen (Canis lupus familiaris) mammary tumors [14] via
apoptotic pathways [15]. It has been successfully used to treat canine
oral papilloma [16] and reported to reduce Bcl–2 and Ki–67 gene
expression in canine mammary adenocarcinoma [17], as well as reduce
aberrant crypt foci (ACF) and polyp formation in colon cancer [18].
In the last stage of apoptosis, caspases, which degrade vital
intracellular proteins, are activated. Bcl–2 is antiapoptotic, and
Bax is proapoptotic. It has been reported that caspase–9 activates
effector caspases [3, 6, 7] that degrade vital cellular proteins and
provide cellular destruction [19]. ACF is observed by staining the
colon tissue of CRC patients with Methylene blue. It has also been
found to be important for early CRC diagnosis [20]. ACF has been
identied as an important parameter in experimental CRC studies
where it is indicative of colon carcinogenesis [21].
TCAE [13] and Capecitabine [6] are individually effective in some
types of cancer. It has been hypothesized that the combined effects
of TCAE and Capecitabine on mitochondrial dysfunction in apoptosis
and ACF in rats with CRC would increase survival compared with
monotherapy. In this study, we determined the effects of combined
and single Capecitabine and TCAE treatment on ACF score and
expression of Bcl–2, Bax, and Cas–3 in rats with CRC.
MATERIALS AND METHODS
Animal material
This study used 96 male Wistar Albino rats (12–16 weeks old,
220–250 g obtained from Selcuk University Experimental Medicine
Application and Research Center, Konya, Turkey. Study protocol
was approved by ethic committee (Ethic No:2019–32). The rats
were randomly divided into eight groups with 12 animals in each
group: Healthy control (C), CRC control (CC), healthy with TCAE (C +
TCAE), CRC with TCAE (CRC + TCAE), healthy with Capecitabine (C +
Capecitabine), CRC with Capecitabine (CRC + Capecitabine), healthy
with TCAE and Capecitabine (C + TCAE+ Capecitabine), and CRC with
TCAE and Capecitabine (CRC + TCAE + Capecitabine). Azoxymethane
(AOM; 15 mg·kg
-1
, intraperitoneal injection (IP), administered twice in
a 1–week interval; Sigma–Aldrich, Germany) was administered to all
CRC groups [18, 22]. The rats in the TCAE groups were administered
TCAE (Theranekron D6 inj; Richter pharma AG, Austria) via IP at a dose
of 0,2 mL/rat for 4 weeks, with 3 days intervals, starting from the 15th
week [18, 23]. Capecitabine (Kapeda tablet, Kocak Farma, Istanbul,
Turkey) groups were orally (PO) administered Capecitabine daily for
30 days at 40 mg·kg
-1
(SID) starting in the 15th week. In the combined
treatment groups, both drugs were administered simultaneously with
the dose and administration method indicated for the single treatment
groups. Rats were sacriced by cervical dislocation one hour after
the last injection using Ketamine (95 mg·kg
-1
, subcutaneous –SC–)
and Xylazine (5 mg·kg
-1
, SC) anesthesia. After the colon tissue was
opened longitudinally and washed with physiological saline, tissue
samples were taken from the proximal, median, and distal regions
and immediately frozen in liquid nitrogen before being stored at –80°C
(Haier, DW–86L628, China) until needed for real–time polymerase chain
reaction (RT–PCR) analysis. The remaining tissue was xed with 10%
formaldehyde for pathological examination.
Molecular analysis
Tissues from six animals from each group were chosen randomly for
RT–PCR analysis. Equal amounts of samples taken from the proximal,
distal, and median portions of the colon were used to represent
the entire colon. Tissues were isolated with an Ribonucleic acids
(RNA) Isolation Kit (Biobasic; Markham, ON, Canada). The A260:A280
ratio was determined with a Total RNA 2000/2000 cycl (c) Nanodrop
Spectrophotometer (Thermo Fisher Scientic; Waltham, MA, USA).
All RNA samples were treated with DNase I (Thermo Fisher Scientic;
Waltham, MA, USA) to remove DNA contamination. Complementary
DNA (cDNA) was synthesized using the iScriptcDNA synthesis kit
(Bio–Rad, Hercules, CA, USA) according to the manufacturer’s
recommended protocol and stored at –20°C until required. The mRNA
information and sequences of the primers used to amplify the target
genes (Bax), (Bcl–2), and (Cas–3) housekeeping gene (GAPDH) are
presented in TABLES I and II, respectively [30, 45, 46]. In addition,
the mRNA and cDNA sequences of the genes were checked with
The National Center for Biotechnology Information (NCBI) GenBank
database (http://www.ncbi.nlm.nih.gov), and the sequences of their
primers were checked with NCBI’s Primer Blast (http://www.ncbi.nlm.
nih.gov/tools/) and the Oligo7 primer design program. The designed
PCR primers were synthesized by Oligomer (Ankara, Turkey).
FIGURE 1. The folding rates according to the RT–PCR results (2
–(∆∆Ct)
± SE of Mean
of log). C: Healthy control, CC: Cancer control, C + TCAE: Healthy TCAE, CRC +
TCAE: Cancer TCAE, C + Capecitabine: Healthy Capecitabine, CRC + Capecitabine:
Cancer Capecitabine, C + Capecitabine + TCAE: Healthy combined, CRC + TCAE
+ Capecitabine: Cancer combined. a,b,c: Different letters in the same column
are statistically signicant (P<0.05)
______________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIII, rcfcv-e33254, 1 – 7
3 of 7
RT–PCR
It was used the iTaq universal SYBR Green kit (Bio–Rad, Hercules,
CA, USA) for all RT–PCR. The thermal cyclic conditions were initial
denaturation at 95 °C for 3 min, followed by 40 cycles of denaturation,
annealing and amplication (95 °C 15 s, Primer TM 30 s, 72 °C 30 s). The
melting curve analysis was performed as follows: 95 °C for 1 min, then
uo–rescence measurements were performed at every 1°C increment
between 65°C and 95°C using the CFX Connect Real–Time PCR
Detection System (Bio–Rad, Hercules, CA, USA). Nuclease–free water
(NFW) was used for the negative control, and optical measurements
were made on both cDNA and PCR mixes for RT–PCR control purposes.
ACF analysis
Colon tissue was xed with 10% formaldehyde and stained with
Methylene blue (0.2%). The ACF score was evaluated under a light
microscope (Olympus Corporation, Tokyo, Japan). The ACF score was
randomly counted and scored at 50 ACFs in each rat colon using the
following scheme: Score 1 = 1–3 crypts; score 2 = 4–6 crypts; score
3 = 7–9 crypts; and score 4 = ≥10 crypts [24].
Statistical analysis
Each gene’s RT–PCR results were normalized using the GAPDH
housekeeping gene. Their fold increase was calculated using the
formula 2
-(∆∆Ct)
[25]. The relationship between fold increases in gene
expression was evaluated using ANOVA with Tukey’s posthoc test.
Crypt counts and scores in ACFs were evaluated with the Mann–
Witney U test in SPSS 22 (Chicago, IL, USA). Tests with P<0.05 were
considered statistically signicant.
RESULTS AND DISCUSSION
Animal material
During this study, one rat in the CRC+TCAE group died, leaving 11
rats in this group. No cancer or drug–related symptoms were observed
during necropsy of this deceased rate.
Determination of primer specicity
A pooled sample was created by mixing 2 µL of cDNA from each
sample, and serial dilutions of 1:2, 1:4, 1:8, and 1:16 ratios were prepared.
RT–PCR–based primer eciencies were determined for each primer.
Primer yields were calculated using the formula 10
-(1/slope)
and TABLEIII
is presented.
TABLE I
References of primers used in the study and NCBI Accession number (No.)
Gene names References NCBI Accession No.
Bax [45] NM_017059.2
Bcl–2 [45] NM_016993.1
Cas–3 [30] NM_012922.2
GAPDH [46] NM_017008.3
TABLE II
Gene names, symbols, sequences and product sizes (bp) of the primers
Gene names Symbols Sequences bp
Bax
Bax–F
GAGAGGTCTTCTTCCGTGTG
133
Bax–R ATCAGCTCGGGCACTTTAG
Bcl–2
Bcl–2–F
TGGTACCTGCAGCTTCTTTC
131
Bcl–2–R ATCTCCAGTATCCCACTCGTAG
Cas–3
Cas–3–F
GAGACAGACAGTGGAACTGACGATG
176
Cas–3–R GGCGCAAAGTGACTGGATGA
GAPDH
GAPDH–F
ACGGCAAGTTCAACGGCACAG
146
GAPDH–R GACGCCAGTAGACTCCACGACA
Primer eciency was calculated by RT–PCR (Bio–Rad, Hercules, CA, USA) using all
cDNAs in the study for each primer
TABLE III
Primer activities used in the study
Primer Slope R
2
Primer ecacy
GAPDH -3,010 0,973 2,15
Bax -3,24 0,9908 2,04
Bcl–2 -3,8202 0,9841 1,83
Cas3 -3,7305 0,9928 1,96
RT–PCR Results with Bax, Bcl–2, and Cas–3
The fold increase results and Bax/Bcl–2 ratios determined with
RT–PCR are shown in FIG. 1.
FIGURE 2. Cancer polyps observed in different groups (yellow arrow; cancer polyp)
40X 100X
CCCCRC+TCAECRC + CapecitabineCRC + TCAE + Capecitabine
FIGURE 3. ACF and crypt appearance in methylene blue stained colon tissue.
C: Healthy control, CC: Cancer control, C + TCAE: Healthy TCAE, CRC + TCAE:
Cancer TCAE, C + Capecitabine: Healthy Capecitabine, CRC + Capecitabine:
Cancer Capecitabine, C + Capecitabine + TCAE: Healthy combined, CRC + TCAE +
Capecitabine: Cancer combined
Effects of Tarantula cubensis extract and Capecitabine in Colorectal Cancer rats / Canbar et al. __________________________________
4 of 7
ACF and Macroscopic Findings
Polyps visible to the naked eye were detected in some animals in
the cancer groups in the study (FIG. 2).
TABLE IV
ACF numbers between groups
Group CC CRC + TCAE
CRC +
Capecitabine
CRC + TCAE +
Capecitabine
Score median 2
a
2
b
2
b
2
b
(Mean ± SE) (2.31 ± 0.05) (1.79 ± 0.05) (1.71 ± 0.04) (1.72 ± 0.04)
Median 5
a
4
b
4
b
4
b
number of crypts
(mean ± SE)
(5.85 ± 0.15) (4.54 ± 0.15) (4.30 ± 0.15) (4.19 ± 0.15)
CC: CANCER control, CRC + TCAE: Cancer TCAE, CRC + Capecitabine: Cancer
Capecitabine, CRC + TCAE + Capecitabine: Cancer combined. a,b: Different letters
on the same line are statistically signicant (P<0.05)
While ACF was not found in healthy rats, it was found in all groups
that were administered AOM. ACF scores and the number of crypts
used to score it (FIG. 3) are shown in TABLE IV.
CRC is one of the most common types of cancer and is known
to cause mortality [1]. In addition to general treatment, research
on alternative treatment options continues [18]. There is limited
information about the use of Capecitabine to treat rats with CRC. The
dose level used in this study is the predictive treatment dose. It was
determined that Capecitabine treatment decreased the ACF score
in rats with CRC. Moreover, a decrease in the ACF score was also
found with combined TCAE and Capecitabine treatment. However,
decreases in the single– and combined–treatment groups were not
signicantly different (P>0.05; TABLE IV).
______________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIII, rcfcv-e33254, 1 – 7
5 of 7
In addition, there was no signicant difference in Cas–3 expression
between groups. However, as a paradoxical or feedback effect, it
was observed that the Bax/Bcl–2 expression ratio was signicantly
lower in the CRC group compared with the control group, which was
primarily due to increases in Bcl–2 expression (P<0.05; FIG. 1). In this
study, Capecitabine was administered at a dose of 40 mg·kg
-1
by
gavage once a day for 30 days. However, the antitumor ecacy of
Capecitabine may be dose–dependent, and a dose of 500 µmol·kg
-1
is required to prevent tumor growth [26].
In addition, intraperitoneal Capecitabine administration at a dose of
10 mg·kg
-1
for two weeks was reported to cause greater weight gains
in rats with CRC than those in the control group and to decrease the
numbers of ACFs and crypts in ACFs [27]. ACF is a diagnostic marker
in CRC, and the ndings are similar in humans and experimental
cancer models [21]. In rats with CRC, 5–FU has been reported to
reduce ACF numbers and colonic mucosa thickness in monotherapy.
In addition, it has been reported that when combined with vitamin
D3 has a synergistic effect, with the number of ACFs reduced to a
greater extent than with 5–FU alone [28].
Administration of metformin or 5–FU in CRC mice has been reported
to reduce the number of ACFs [29]. Bax is proapoptotic, and Bcl–2 is
antiapoptotic. In addition, Bax and Bcl–2 are active in Cas–3–mediated
apoptosis due to mitochondrial dysfunction. Cas–3 is activated by
Cas–9 and induces cellular apoptosis [30]. The expression of these
genes changes after the exposure of C6 cell cultures to Ru2Cl (Ibp)4,
where Bax expression increases at the 6th and 24th h but remains
similar to its level at the 0th and 72 nd h. The expression of Bcl–2 is
also signicantly higher in the 24th h before decreasing to levels
similar to the control group [31].
However, Bax expression does not change in cancer cells 24
hours after 5–FU administration, but Bcl–2 expression decreases
[32]. Bax expression does not change in cancer cells when 5–FU,
N–acetylcysteine, and vitamin E are given individually, but it does
increase when they are given together [33]. However, while Bax
protein levels increase over time in the presence of andrographolide,
its mRNA levels do not change [34]. In CRC cell lines, the micro–RNA
miR–206 is directly associated with Bcl–2 and plays a crucial role in the
development of 5–FU resistance [35]. The Cas–3 protein ratio does
not change when 5–FU is administered to 5–FU–resistant cells [36].
However, in future studies, it will be important to jointly determine
changes in Cas–3, Bax, and Bcl–2 mRNA and protein levels at different
times in order to evaluate the ecacy of the drugs used. While the
prognostic potential of Capecitabine is better than the ACF score, a
paradoxical or feedback effect exists at the mRNA level. However, the
fact that Cas–3 mRNA levels did not change in this study may indicate
that the paradoxical or feedback effect observed in Capecitabine
administered groups was limited to the Bax and Bcl–2 genes.
In this study, a non–statistical synergistic effect was observed
with Capecitabine, where TCAE reduced the ACF score in rats with
CRC (P<0.05; TABLE IV). In addition, it was determined that TCAE
decreased the Bax/Bcl–2 ratio in healthy rats and increased it in
rats with CRC. It was determined that the increase in this ratio was
due to increased Bax expression in rats with CRC. In addition, it
was observed that when used in combination with Capecitabine, it
increased the Bcl–2 gene in healthy animals. (P<0.05; FIG. 1). TCAE
is reported to disrupt cellular adhesion, increase cell death rate
depending on the concentration, be more cytotoxic in cancer cells,
and trigger apoptosis through cas–3 [13]. It has been shown that the
combination of these drugs is effective in slowing down the growth of
this type of tumor, however, more studies are required to determine
which combination of doses is the most effective and which is the
mechanism by which these effects occur. Er et al. [37] reported that
TCAE causes uctuations in IL–6 and IL–10 levels and an increase in
TNF–α and TGFβ levels in cancerous cells. In addition, TCAE reportedly
inhibits the proliferation of cancer cells depending on concentration
and time. However, cell death due to TCAE is not specic to cancer
cells, as it was also observed in healthy cells. It has been suggested
that cell death may be related to the Ethanol used in the extraction
process [38]. It was found in the study that TCAE inhibited tumor
development and proliferation and stimulated non–mutagenic tumor
suppressor genes [39].
In addition, tarantula–logoplex is reported to be less cytotoxic in
healthy cells than in cancerous [40]. Er et al. [18] found that TCAE
administration in rats with CRC decreased the number of ACFs
and increased levels of PGE–2, IL–2, and IL–10. TCAE is reported to
suppress increases in midkine, TGF–β, VEGF, AFP, COX–2, IGF, and
Cas–3 levels in the colon [41]. It has been reported that Flavanol
can change Bax and Bcl–2 expression levels at different rates in
different cell lines [42]. It has also been reported that Bax expression
is increased in the indigestible part of the bean compared to the
cancer group, but Bcl–2 expression is decreased in rats with cancer
in AOM [43]. The application of different types of bacteria to rats
with cancer was found to reduce levels of cas–3 mRNA but prevent
cancer development via a different mechanism [44]. It can be
concluded that TCAE can act specically on cancer cells and trigger
apoptosis through Bax in rats with cancer, slowing down cancer
development through increased Bax expression, which is important
for cancer development. While TCAE and Capecitabine have similar
treatment ecacy in their single and combined uses, a non–statistical
synergistic effect is observed in the combined use.
CONCLUSION
In this study, İt was aimed to determine the ecacy and type of
effect of Capecitabine and TCAE in rats with CRC induced by AOM.
At the molecular level, TCAE activity differed in healthy and CRC rats.
However, it can be stated that TCAE can slow down the development
of cancer by increasing Bax expression, which generally decreases in
cancer. It is remarkable that it affects apoptosis mechanisms in rats
with cancer but not in healthy animals. Future studies in this area will
improve understanding of its mechanism of action. Capecitabine may
have a paradoxical or feedback effect when used as gavage once a day
for 30 days at a dose of 40 mg·kg
-1
in rats. While it was observed to not
induce apoptosis, it did reduce ACF scores, which are a diagnostic
marker for CRC. A non–statistical increase in ecacy was observed
with the combined use of TCAE and Capecitabine, which might be
caused by a drug–drug interaction. In addition, more in vivo studies
are required to explore different dose concentrations for both drugs.
Conict of interest
The authors declare that they have no conict of interest.
ACKNOWLEDGMENTS
This work was supported by research funding from SUBAPK
(19202080). We thanks to TUBITAK for scientist training program
(2211–c)
Effects of Tarantula cubensis extract and Capecitabine in Colorectal Cancer rats / Canbar et al. __________________________________
6 of 7
BIBLIOGRAPHIC REFERENCES
[1] Ferlay J, Colombet M, Soerjomataram I, Mathers C, Parkin
D, Piñeros M, Znaor, A, Bray, F. Estimating the global cancer
incidence and mortality in 2018: GLOBOCAN sources and
methods. Internat. J. Cancer. 2019; 144(8):1941–53.
[2] Arteaga TA, McKnight J, Bergman PJ. A review of 18 cases
of feline colonic adenocarcinoma treated with subtotal
colectomies and adjuvant carboplatin. J. the Amer. Anim.
Hospital Asso. 2012; 48(6):399–404.
[3] Markowitz SD, Bertagnolli MM. Molecular basis of colorectal
cancer. New England J. Med. 2009; 361(25):2449–60.
[4] Mármol I, Sanchez de Diego C, Pradilla–Dieste A, Cerrada E,
Rodriguez–Yoldi M. Colorectal carcinoma: a general overview
and future perspectives in colorectal cancer. Internat. J.
Molecular Sci. 2017; 18(1):197.
[5] Lou Y, Wang Q, Zheng J, Hu H, Liu L, Hong D, Zeng S. Possible
pathways of Capecitabine–induced hand–foot syndrome. Chem.
Res. Toxicol. 2016; 29(10):1591–601.
[6] Midgley R, Kerr DJ. Capecitabine: have we got the dose right?
Nature Rev. Clin. Oncol. 2009; 6(1):17.
[7] Hirsch BR, Zafar SY. Capecitabine in the management of
colorectal cancer. Cancer Manag. Res. 2011; 3:79–89.
[8] Shindoh H, Nakano K, Yoshida T, Ishigai M. Comparison of in
vitro metabolic conversion of Capecitabine to 5–FU in rats,
mice, monkeys and humans–toxicological implications. J.
Toxicol. Sci. 2011; 36(4):411–22.
[9] Sakai S, Kobuchi S, Ito Y, Sakaeda T. Assessment of
pharmacokinetic variations of Capecitabine after multiple
administration in rats: a physiologically based pharmacokinetic
model. Cancer Chemotherap. Pharmacol. 2020; 85(5):869–80.
[10] Walko CM, Lindley C. Capecitabine: a review. Clin.
Therap. 2005; 27(1):23–44.
[11] Schüller J, Cassidy J, Dumont E, Roos B, Durston S, Banken
L, Utoh M, Mori K, Weidekamm E, Reigner B. Preferential
activation of Capecitabine in tumor following oral administration
to colorectal cancer patients. Cancer Chemotherap.
Pharmacol. 2000; 45(4):291–7.
[12] Richardson–Boedler C. The brown spider Loxosceles laeta: source of
the remedy Tarentula cubensis? Homeopathy. 2002; 91(03):166–70.
[13] Ghasemi–Dizgah A, Nami B, Amirmozafari N. Tarantula cubensis
venom (Theranekron®) selectively destroys human cancer
cells via activating caspase–3–mediated apoptosis. Acta
Med. Intern. 2017; 4(1):74.
[14] Gultekin N, Vural M. The effect of Tarantula cubensis extract
applied in pre and post–operative period of canine mammary
tumors. J. Istanbul Vet. Sci. 2007; 2(1):13–23.
[15] Gultiken N, Guvenc T, Kaya D, Agaoglu AR, Ay SS, Kucukaslan I,
Emre B, Findik M, Schäfer–Somi S, Aslan S. Tarantula cubensis
extract alters the degree of apoptosis and mitosis in canine
mammary adenocarcinomas. J. Vet. Sci. 2015; 16(2):213–9.
[16] Icen H, Sekin S, Simsek A, Kochan A, Tunik S. The ecacy of
Tarantula cubensis extract (Theranekron) in treatment of canine
oral papillomatosis. Asian J. Anim. Vet. Adv. 2011; 6:744–9.
[17] Karayannopoulou M, Laoniatis S. Recent advances on canine
mammary cancer chemotherapy: A review of studies from 2000
to date. Breast Cancer Res. 2016; 29(32):43.
[18] Er A, Ozdemir O, Coskun D, Dik B, Bahcivan E, Faki HE,
Yazar E. Effects of Tarantula cubensis alcoholic extract and
Nerium oleander distillate on experimentally induced colon
cancer. Develop. 2019; 45:47.
[19] Adams JM, Cory S. The BCL–2 arbiters of apoptosis and their
growing role as cancer targets. Cell Death Different. 2018; 25(1):27.
[20] Pretlow TP, Barrow BJ, Ashton WS, O'Riordan MA, Pretlow TG,
Jurcisek JA, Stellato TA. Aberrant crypts: putative preneoplastic
foci in human colonic mucosa. Cancer Res. 1991; 51(5):1564–7.
[21] Bird RP, Good CK. The signicance of aberrant crypt foci in
understanding the pathogenesis of colon cancer. Toxicol.
Lett. . 2000; 112:395–402.
[22] Tan BL, Esa NM, Rahman HS, Hamzah H, Karim R. . Brewers’ rice
induces apoptosis in azoxymethane–induced colon carcinogenesis
in rats via suppression of cell proliferation and the Wnt signaling
pathway. BMC Complem. Alternat. Med. 2014; 14(1):304.
[23] Özdemir Ö, Akçakavak G, Tuzcu M. Effect of Tarantula cubensis
alcoholic extract and Nerium oleander distillate on cell
proliferation markers in colon carcinogenesis. Rev. Cientif.
FCV–LUZ. 2022; 33(1):e–31250. doi: https://doi.org/kdc7
[24] Kristiansen E. The role of aberrant crypt foci induced by the
two heterocyclic amines 2–amino–3–methyl–imidazo [4, 5–f]
quinoline (IQ) and 2–amino–1–methyl–6–phenyl–imidazo [4, 5–b]
pyridine (PhIP) in the development of colon cancer in mice.
Cancer Lett. 1996; 110(1–2):187–92.
[25] Livak KJ, Schmittgen TD. Analysis of relative gene expression
data using real–time quantitative PCR and the 2− ΔΔCT method.
Methods. 2001; 25(4):402–8.
[26] Sakai S, Kobuchi S, Ito Y, Sakaeda T. A Physiologically Based
Pharmacokinetic–Pharmacodynamic Model for Capecitabine
in Colorectal Cancer Rats: Simulation of Antitumor Ecacy
at Various Administration Schedules. Europ. J. Drug Metabol.
Pharmacokin. 2021; 46(2):301–15.
[27] Dudhipala N, Puchchakayala G. Capecitabine lipid nanoparticles for
anti–colon cancer activity in 1, 2–dimethylhydrazine–induced colon
cancer: preparation, cytotoxic, pharmacokinetic, and pathological
evaluation. Drug Develop. Industr. Pharm. 2018; 44(10):1572–82.
[28] Refaat B, El–Shemi AG, Kensara OA, Mohamed AM, Idris S,
Ahmad J, Khojah A. Vitamin D3 enhances the tumouricidal
effects of 5–Fluorouracil through multipathway mechanisms
in azoxymethane rat model of colon cancer. J. Experim. Clin.
Cancer Res. 2015; 34(1):1–15.
[29] Abd AH, Hussein AG, Mahmood AS. Ecacy of intraperitoneal
administration of metformin and 5–uoruracil in prevention of
induced colorectal aberrant crypt foci in mice. Intern. J. Pharm.
Pharmaceut. Sci. 2014; 6:305–8.
______________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIII, rcfcv-e33254, 1 – 7
7 of 7
[30] Chen S, Peng H, Rowat A, Gao F, Zhang Z, Wang P, Zhang W, Wang,
X, Qu L. The effect of concentration and duration of normobaric
oxygen in reducing caspase–3 and–9 expression in a rat–model
of focal cerebral ischaemia. Brain Res. 2015; 1618:205–11.
[31] Benadiba M, Dos Santos RRP, Silva Dde O, Colquhoun A. Inhibition
of C6 rat glioma proliferation by [Ru2Cl (Ibp) 4] depends on
changes in p21, p27, Bax/Bcl2 ratio and mitochondrial membrane
potential. J. Inorganic Biochem. 2010; 104(9):928–35.
[32] Novak M, Žegura B, Baebler Š, Štern A, Rotter A, Stare K, Filipic
M. Inuence of selected anti–cancer drugs on the induction
of DNA double–strand breaks and changes in gene expression
in human hepatoma HepG2 cells. Environm. Sci. Pollut.
Res. 2016; 23(15):14751–61.
[33] Adeyemo D, Imtiaz F, Toffa S, Lowdell M, Wickremasinghe R,
Winslet M. Antioxidants enhance the susceptibility of colon
carcinoma cells to 5–uorouracil by augmenting the induction
of the bax protein. Cancer Lett. 2001; 164(1):77–84.
[34] Wang W, Guo W, Li L, Fu Z, Liu W, Gao J, Shu Y, Xu Q, Sun Y,
Gu Y. Andrographolide reversed 5–FU resistance in human
colorectal cancer by elevating BAX expression. Biochem.
Pharmacol. 2016; 121:8–17.
[35] Meng X, Fu R. miR–206 regulates 5–FU resistance by targeting
Bcl–2 in colon cancer cells. OncoTargets Therapy. 2018; 11:1757.
[36] Li J, Hou N, Faried A, Tsutsumi S, Kuwano H. Inhibition of autophagy
augments 5–uorouracil chemotherapy in human colon cancer
in vitro and in vivo model. Europ. J. Cancer. 2010; 46(10):1900–9.
[37] Er A, Corum O, Corum D, Hitit M, Donmez H, Guzeloglu A. Alcoholic
extract of Tarantula cubensis induces apoptosis in MCF–7 cell
line. Biomed. Res. 2017; 28(8):3660–3665
[38] Yenigun VB, Azzawri AA, Acar MS, Kaplan MB, Ucar VB,
Tastekin D, Acar H. Alcoholic extract of Tarantula cubensis
(Theranekron®) induce autophagy on gastric cancer cells. Experim.
Biomed. Res. 2021; 4(2):89–98.
[39] Akcakavak G, Ozdemır O. Effect of Tarantula cubensis alcoholic
extract on tumour pathways in azoxymethane–induced colorectal
cancer in rats. Acta Vet. Brno. 2023; 92(1):79–88.
[40] ilhan S. Can a Veterinary Drug be Repurposed for Human
Cancers?: Cytotoxic Effect of Tarantula cubensis Venom on
Human Cancer Cells. J. Instit. Sci. Technol. 2021; 11(3):1763–9.
[41] Dik B, Coskun D, Er A. Protective Effect of Nerium oleander
Distillate and Tarantula cubensis Alcoholic Extract on Cancer
Biomarkers in Colon and Liver Tissues of Rats with Experimental
Colon Cancer. Anti–Cancer Agents Med. Chem. 2022; 22(10):1962–9.
[42] Lewandowska U, Szewczyk K, Owczarek K, Hrabec Z, Podsedek
A, Koziołkiewicz M, Hrabec E. Flavanols from evening primrose
(Oenothera paradoxa) defatted seeds inhibit prostate cells
invasiveness and cause changes in Bcl–2/Bax mRNA ratio. J.
Agricult. Food Chem. 2013; 61(12):2987–98.
[43] Haydé V–C, Ramón G–G, Lorenzo G–O, Dave OB, Rosalía R–C,
Paul W, Guadalupe L–P. Non–digestible fraction of beans
(Phaseolus vulgaris L.) modulates signalling pathway genes at
an early stage of colon cancer in Sprague–Dawley rats. British
J. Nutr. 2012; 108(S1):S145–S54.
[44] Kuugbee ED, Shang X, Gamallat Y, Bamba D, Awadasseid A,
Suliman MA, Zang S, Ma Y, Chiwala G, Xin Y. Structural change
in microbiota by a probiotic cocktail enhances the gut barrier
and reduces cancer via TLR2 signaling in a rat model of colon
cancer. Digest. Dis. Sci. 2016; 61(10):2908–20.
[45] Dik B, Sonmez G, Faki HE, Bahcivan E. Sulfasalazine treatment
can cause a positive effect on LPS–induced endotoxic rats.
Experim. Anim. 2018; 67(4):403–12.
[46] Li P, Jiang H, Wu H, Wu D, Li H, Yu J, Lai J. AH6809 decreases
production of inammatory mediators by PGE2–EP2–cAMP
signaling pathway in an experimentally induced pure cerebral
concussion in rats. Brain Res. 2018; 1698:11–28.
