Keywords:

Barley

Durum wheat

Fusarium

Identication

Prospection

Occurrence, distribution and molecular analysis of Fusarium head blight on cereals in

Northeast Algeria

Presencia, distribución y análisis molecular de la fusariosis de la espiga en cereales del noreste de

Argelia

Ocorrência, distribuição e análise molecular de Fusarium ear blight em cereais no nordeste da Argélia

Alaeddine Belgacem

Abdelkrim Mebarkia*

Rev. Fac. Agron. (LUZ). 2025, 42(1): e244216

ISSN 2477-9407

DOI: https://doi.org/10.47280/RevFacAgron(LUZ).v42.1.XVI

Crop production

Associate editor: Dra. Lilia Urdaneta

University of Zulia, Faculty of Agronomy

Bolivarian Republic of Venezuela

Department of Agronomic Sciences, Faculty of Nature and

Life Sciences, Laboratory of Applied Microbiology, Ferhat

ABBAS University – Setif 1, Algeria.

Received: 26-09-2024

Accepted: 09-02-2025

Published: 10-03-2025

Abstract

Fusarium head blight (FHB) aects cereals by reducing

yield quality and quantity. This study aimed, on the one hand, to

evaluate the prevalence, severity, and incidence of this disease on

durum wheat and barley elds in the High Setian Plains Region

Northeast of Algeria and, on the other hand, to identify Fusarium

species. Durum wheat and barley elds were prospected, and

FHB-symptomatic samples were collected during two crop years

(2018-2019). The prevalence, incidence, and severity results

on durum wheat during the rst crop year were 6 %, 12.1 %,

and 56.2 %, and on barley, were 23.77 %, 10.22 %, and 49.7 %,

respectively. However, in the second crop year, on wheat were 2.5 %,

3 %, and 35 %, and on barley were 35 %, 10.86 %, and 44.29 %,

respectively. Morphological characterization was used to select

the 102 isolates. They were then identied by molecular analysis

by PCR amplication and sequencing of the internal transcribed

spacers (ITS) and β-tubulin (tub2) or translation elongation factor

1-alpha (tef1). Thus, seven species of Fusarium were identied,

namely, F. equiseti (27.45 %), F. graminearum (25.49 %), F.

acuminatum (19.6 %), F. oxysporum (13.73 %), F. proliferatum (9.8

%), F. avenaceum (1.96 %), F. incarnatum (1.96 %). In addition,

Fusarium proliferatum and F. oxysporum were reported for the rst

time in Algerian elds.

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2025, 42(1): e254216 January-March. ISSN 2477-9409.

2-6 |

Resumen

La fusariosis de la espiga (FHB) afecta a los cereales reduciendo la

calidad y cantidad del rendimiento. Este estudio tuvo como objetivo,

por un lado, evaluar la prevalencia, la severidad y la incidencia de

esta enfermedad en los campos de trigo duro y cebada en la región de

las llanuras altas de Setian, al noreste de Argelia, y, por otro lado,

identicar las especies de Fusarium. Se prospectaron los campos de

trigo duro y cebada y se recogieron muestras sintomáticas de FHB

durante dos campañas agrícolas (2018-2019). Los resultados de

prevalencia, incidencia y gravedad en el trigo duro durante la primera

campaña fueron del 6 %, 12.1 % y 56.2 %, y en la cebada, del 23.77

%, 10.22 % y 49.7 %, respectivamente. Sin embargo, en la segunda

campaña, en el trigo fueron del 2.5 %, 3 % y 35 %, y en la cebada

del 35 %, 10.86 % y 44.29 %, respectivamente. Se seleccionaron

los 102 aislamientos mediante caracterización morfológica, que se

identicaron a través del análisis molecular mediante amplicación

por PCR y secuenciación de los espaciadores transcritos internos

(ITS) y de la β-tubulina (tub2) o del factor de elongación de la

traducción 1-alfa (tef1). De esta forma, se identicaron siete especies

de Fusarium, F. equiseti (27.45 %), F. graminearum (25.49 %), F.

acuminatum (19,6 %), F. oxysporum (13.73 %), F. proliferatum

(9.8 %), F. avenaceum (1.96 %), F. incarnatum (1.96 %). Además,

Fusarium proliferatum y F. oxysporum se reportaron por primera vez

en campos argelinos.

Palabras clave: cebada, Fusarium, identicación, prospección, trigo

duro.

Resumo

A giberela (FHB) afeta os cereais reduzindo a qualidade e a

quantidade da produção. Este estudo teve como objetivo, por um

lado, avaliar a prevalência, a severidade e a incidência desta doença

em campos de trigo duro e cevada na região das Planícies Altas de

Setian, a nordeste da Argélia e, por outro lado, identicar espécies

de Fusarium. Campos de trigo duro e cevada foram prospectados,

e amostras sintomáticas de FHB foram coletadas durante dois anos

de safra (2018-2019). Os resultados de prevalência, incidência e

severidade no trigo duro durante o primeiro ano de safra foram de

6 %, 12,1 % e 56,2 %, e na cevada, foram de 23,77 %, 10,22 %

e 49,7 %, respectivamente. No entanto, no segundo ano de safra, o

trigo foi de 2,5 %, 3 % e 35 %, e a cevada foi de 35 %, 10,86 %

e 44,29 %, respectivamente. A caracterização morfológica foi usada

para selecionar os 102 isolados. Eles foram então identicados por

análise molecular por amplicação por PCR e sequenciamento dos

espaçadores transcritos internos (ITS) e β-tubulina (tub2) ou fator

de alongamento de tradução 1-alfa (tef1). Assim, sete espécies de

Fusarium foram identicadas, F. equiseti (27,45 %), F. graminearum

(25,49 %), F. acuminatum (19,6 %), F. oxysporum (13,73 %), F.

proliferatum (9,8 %), F. avenaceum (1,96 %), F. incarnatum (1,96 %).

Além disso, Fusarium proliferatum e F. oxysporum foram relatados

pela primeira vez em campos argelinos.

Palavras-chave: cevada, Fusarium, identicação prospecção, trigo

duro.

Introduction

Traditionally, cereals are considered the most consumed food in

Algeria, in the form of bread, pasta, couscous, and other products of

the food industry. The region of High Setian Plains, northeast of

Algeria, has a cereal vocation with 194,520 ha sown in 2020 (MADR,

2020). Unfortunately, many fungal diseases, such as Fusarium head

blight (FHB), threaten these crops by various Fusarium species.

Many small grains, including wheat and barley, are considered a

target (Moretti, 2009). In addition, FHB is a worldwide pathology

causing a signicant eect on the quality and the quantity of cereal

yields (Parry et al., 1995; Matny, 2015), inducing harvest losses

and price discounts (Nganje et al., 2004), the majority impact of

these losses appears on wheat and barley production (Wegulo et al.,

2015). The FHB is becoming an increasing constraint for wheat and

barley production worldwide and in Algeria (Yekkour et al., 2015).

However, several Fusarium species generate mycotoxins on cereals

at the growth, harvest, and post-harvest stages (Venkataramana et

al., 2018). These mycotoxins can cause serious health problems

in animals and humans (Parry et al., 1995; Ma et al., 2013). Thus,

many Fusarium species are associated with FHB disease (Parry et al.,

1995), developing under specic conditions, in particular, rainfall,

temperature, owering stage, and other agronomic practices, such as

crop rotation and plant genotype (Bottalico and Perrone, 2002). In

Algeria, a few studies on FHB disease were published: Yekkour et al.

(2015), Touati-Hattab et al. (2016), Laraba et al. (2017a), Bencheikh

et al. (2018), Bencheikh et al. (2020) and Abdallah-Nekache et

al. (2019). These publications do not exclude the presence of other

species that have not yet been reported in Algeria. This study aimed

to evaluate the prevalence, severity, and incidence of Fusarium head

blight (FHB) on durum wheat and barley in the High Setian Plains

Region Northeast of Algeria and to identify Fusarium isolates.

Materials and methods

Disease prospection, sampling, and assessment

Fusarium head blight was prospected in 262 durum wheat and

barley elds in the high Setian plains region (Northeast Algeria)

between May and July during two agricultural seasons (2018-2019).

Thus, symptomatic samples of head blight were randomly collected

and put in paper bags. The number of samples was taken depending

on the incidence rate from four dierent directions of the same eld,

and GPS coordinates were recorded. The prevalence (P), incidence

(I), and severity (S) of this fungal disease were estimated visually.

The prevalence was determined by the proportion of infected elds

in prospected ones (Zahri et al., 2014); incidence was determined by

averaging infected spikes in each eld (Stack and McMullen, 1998).

Also, severity was determined by averaging infection in infected

spikes (Stack and McMullen, 1998). For statistical analysis, means

and standard deviations of incidence and severity were calculated.

Maps were created with ArcGIS software using GPS coordinates data

to illustrate the distribution of prospected elds and the dispersion

of FHB disease. Humidity, precipitation, and temperature during the

owering period were collected to interpret the results from www.

historique-meteo.net.

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Belgacem

and Mebarkia. Rev. Fac. Agron. (LUZ). 2025, 42(1): e254216

3-6 |

Isolation and molecular identication of FHB disease:

Pathogen isolation

Media culture: PDA (Potato Dextrose Agar) was used as a

selective media in 90 mm Petri dishes.

Isolation: According to Laraba et al. (2017b), with slight

modications from infected wheat and barley ears samples. Grains

were rinsed for 10 min in 2 % sodium hypochlorite three times and

then washed with distilled and sterilized water. After all, these grains

were placed in Petri dishes containing the PDA medium and incubated

at 28 °C for 7 d.

Monoconidiale culture: According to Zhang et al. (2013), with

slight modications, Fusarium isolates were puried using spores’

cultures.

Morphologic characterization: After the purication, isolates

were cultured in the PDA culture media, Spezieller Nahrstoarmer

Agar (SNA), and Sabouraud Dextrose Agar (SDA) for morphologic

identications according to Nelson et al. (1983) and Leslie et al.

(2006). Based on morphological characterization, Fusarium isolates

were grouped into clusters, and one isolate was taken for molecular

identication from each cluster. Photos of the morphological

characters of Fusarium species were taken, particularly on Petri

dishes and microscopic characters of macroconidias, microconidias,

and chlamydospores.

Molecular analysis

DNA extraction: was performed using a commercial NucleoSpin

Plant II kit (Macherey-Nagel Germany).

PCR amplication: The polymerase chain reaction (PCR) was

amplied at the level of the partial regions ITS, and β-tubulin (just

for F05 was amplied translation elongation factor 1 alpha (EF-1

α) using specic primer sequences (table 1) composed of a 25 µL

mixture: 0.2 µL of mgcl 2, 5 µL Taq buer (solisbiodyn), 1 µL of

Table 1. Primers used in molecular analysis of Fusarium species isolated from barley and wheat grains elds in the Setif region of Algeria.

Primers Sequence 5’-3’

Optimal annealing

T (°C)

Product size

(pb)

Reference

ITS

I T S - 1 F

ITS4-B

CAGGAGACTTGTACACGGTCCAG

CTTGGTCATTTAGAGGAAGTAA 55 600

Gardes and Bruns (1993)

β-tubulin

Forward

Reverse

GGTAACCAAATCGGTGCTGCTTTC

ACCCTCAGTGTAGTGACCCTTGGC 54 495

Glass and Donaldson (1995)

EF-1α

Forwa r d

Reverse

CATCGAGAAGTTCGAGAAGG

TACTTGAAGGAACCCTTACC 58 600

Carbone and Kohn (1999)

Table 2. Prospection of Fusarium head blight (FHB) during 2 years on durum wheat and barley elds in the Setif region of Algeria.

Cereal Species

Severity % Incidence % Prevalence % Infected elds Total prospected elds

2018 2019 2018 2019 2018 2019 2018 2019 2018 2019

Durum wheat

56.2 35 12.1 3 6 2.5 5 1 81 39

σ 19.68 0 3.47 0

Barley

47.9 44.29 10.22 10.86 23.77 35 29 7 122 20

σ 5.23 25.4 5.23 2.89

µ: mean and σ: standard deviation

direct starch, 1 µL of reward starch, 0.2 µL of dNTP, 0.2 µL of Taq

polymerase (solisbiodyn), 2 µL of genomic DNA and ultra-pure

water. The temperature for annealing was 55 °C for ITS (Gardes and

Bruns, 1993), 58 °C for EF-1 α (Carbone and Kohn, 1999), and 54°C

for β-tubulin (Glass and Donaldson,1995).

PCR product revelation and purication: 10 µL of the PCR

product was put in a 1.5 % agarose electrophoresis gel, followed by

a bath in 0.5 µg.mL

-1

of Ethidium Brom (Bartlett and Stirling, 2003).

The DNA was visualized and photographed under UV (Biorad gel doc

systems USA), and then this product was puried with the NucleoSpin®

Gel kit and PCR clean-up (Macherey Nagel Germany).

DNA sequencing: The nal PCR product was sequenced using the

Sanger et al. (1977) technique using the BigDye V3.1 Kit (Applied

Biosystems). Depending on the quality of the sequencing results, these

sequences were edited with BioEdit software. The sequence results

were compared with the Blast database. Finally, sequences were

submitted with ID numbers in GenBank.

Results and discussion

Prospection: The total number of elds prospected was 262 (table

2), with 142 of barley and 120 of durum wheat. Figure 1 illustrates the

geographic distribution of the disease in the study region.

The evaluation of Fusarium head blight (FHB) on barley and

durum wheat elds in the study region (table 2) showed that the

prevalence was 23.77 % and 6 %, respectively, and severity was 47.9

% and 56.2 %, respectively. The incidence was 10.22 % and 12.1 %,

respectively, during the rst year. However, during the second year, the

prevalence was 35 % and 2.5 %, while the severity was 44.29 % and

35 %, respectively. The incidence was 10.86 % and 3 % respectively.

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2025, 42(1): e254216 January-March. ISSN 2477-9409.

4-6 |

Figure 1. Map of Fusarium head blight (FHB) results in durum

wheat and barley elds in the Setif region of Algeria

using ArcGIS. (♦): not infected Durum wheat elds. (▲):

infected Durum wheat eld. (■): not infected Barley eld.

(●): infected Barley eld.

These results corroborate the climatic conditions during these two

agricultural seasons in the study area (table 3); in 2018 the rst year

of prospection, the number of infected elds was higher than in the

second year, caused by a favorable climate for disease infection with

Fusarium species. Counter wise, the decrease in infected elds with

FHB disease was observed in the second year of prospection when

the climate was hotter and less humid; these factors were unfavorable

for the disease development. According to Osborne and Stein (2007),

the environment is the primary factor in the spread of Fusarium

pathogen. These factors are essentially rain and warm temperature

at the period of anthesis with the presence of the Fusarium pathogen

(Alisaac and Mahlein, 2023).

Table 3. Climatic variables (temperature, precipitation and

humidity) of the Setif region of Algeria in 2018 and 2019.

Year Month

Temperature

(°C)

Precipitation (mm)

Humidity

(%)

2018

May 18 155 77

June 17 99 67

2019

May 24 65 61

June 28 10 43

https://www.historique-meteo.net

Isolation and molecular analysis: The total number of Fusarium

isolates obtained in two years of prospection was 102 (table 4). In the

rst year, 93 Fusarium isolates were obtained, 76 on barley and 17 on

wheat. However, 9 Fusarium isolates were obtained from barley and

wheat during the second year, seven on barley and two on wheat. The

decrease was near 90 % between the 2 years.

Table 4. Fusarium species isolated from infected elds in the Setif

region of Algeria F. avenaceum: F. ave., F. acuminatum:

F. acu., F. oxysporum: F. oxy., F. proliferatum: F. pro., F.

incarnatum: F. inc., F. equiseti: F. equ. and F. graminearum:

F. gra.).

Species

ave.

acu.

oxy.

pro.

inc

equ.

gra.

Total

I s o l a t e s

number

2018 2 20 14 9 0 24 24 93

2019 0 0 0 1 2 4 2 9

Total 2 20 14 10 2 28 26 102

Percentage

(%)

1.96 19.61 13.73 9.8 1.96 27.45 25.49 100

Durum

wheat

01 04 05 03 00 02 06 21

Barley 01 16 09 07 02 26 20 81

Table 4 illustrates the number of Fusarium isolates gathered in

durum wheat and barley elds. Therefore, Fusarium species obtained

from barley were 81 isolates (76.9 %) and those obtained from durum

wheat were 21 (23.1 %). In addition, F. incarnatum has only been

isolated from barley elds. This dierence between the number of

infected durum wheat elds and the number of infected barley elds

by FHB disease resulted from their dierence in the period of cereals

growth stage: inorescence emergence and anthesis (Zadoks et al.,

1974). These two stages are the period when Fusarium species infect

cereals in a favorable climate. However, in the region of study, these

two stages occurred at the beginning of May for barley coincided

with a favorable environment for FHB disease development, and the

beginning of June for durum wheat coincided with an unfavorable

climate for FHB disease development.

The results of the molecular analysis of the ten Fusarium

isolates (table 5) allowed the identication of seven dierent species

of Fusarium: F. avenaceum (1.96 %), F. acuminatum (19.6 %), F.

oxysporum (13.73 %), F. proliferatum (9.8 %), F. incarnatum (1.96

%), F. equiseti (27.45 %) and F. graminearum (25.49 %).

The distribution of Fusarium species in the study region was

as follows: in the South (F. oxysporum and F. acuminatum); in the

North (F. graminareaum, F. avenaceum

, F. proliferatum, F. equiseti,

and F. oxysporum) and the Center (F. avenaceum, F. acuminatum,

F. oxysporum, F. proliferatum, F. incarnatum, F. equiseti, and F.

graminearum). As a result, we noticed that the central region was

more infected with Fusarium species than the North and the South;

this is explained by the dierent bioclimatic oors in the study region

(Tedjari et al., 2014; Djellouli et al., 2020).

This study showed this region’s diversity of Fusarium species

(table 4 and gure 2). This diversity is dominated by F. equiseti

(27.45 %), followed by F. graminearum (25.49 %), and nally F.

acuminatum (19.61 %). Moreover, this study allowed us to identify

and characterize for the rst time two species, namely F. oxysporum

(isolate F03, submitted with an identication number OR228993

and PQ279785 in GenBank for ITS partial regions and β-tubulin

respectively) and Fusarium proliferatum (isolate F04, submitted with

an accession number OR594284 and PQ301480 in GenBank for ITS

partial regions and β-tubulin respectively).

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Belgacem

and Mebarkia. Rev. Fac. Agron. (LUZ). 2025, 42(1): e254216

5-6 |

Table 5. Fusarium sequences submitted in NCBI Gen bank and

their accession number.

Fusarium species Host Primers

Accession

number

GenBank

F01.alasetif Isolate :

F. avenaceum

- F02.alasetif isolate :

F. acuminatum

- F03.alasetif isolate :

F. oxysporum

- F04.alasetif isolate:

F. proliferatum

- F05.alasetif isolate:

F. acuminatum

- F07.alasetif isolate :

F. incarnatum

- F08.alasetif isolate :

F. equiseti

- F10.alasetif isolate :

F. graminearum

- F11 alasetif isolate :

F. equiseti

- F13.alasetif isolate :

F. equiseti

Durum

Wheat head

Barley’s

head

Barley’s

head

Barley’s

head

Barley’s

head

Barley’s

head

Barley’s

head

Barley’s

head

Barley’s

head

Barley’s

head

Partials regions ITS

β-tubulin

Partials regions ITS

β-tubulin

Partials regions ITS

β-tubulin

Partials regions ITS

β-tubulin

Partials regions ITS

Elongation factor 1-α

Partials regions ITS

β-tubulin

Partials regions ITS

β-tubulin

Partials regions ITS

β-tubulin

Partials regions ITS

β-tubulin

Partials regions ITS

β-tubulin

OR225820

OR267009

OR228995

OR608511

OR228993

PQ279785

OR594284

PQ301480

OR228992

PQ332999

OR228997

PQ301481

OR228998

PQ316047

OR228990

PQ305980

OR228994

PQ333000

OR228996

PQ360734

Figure 2. Morphologic characteristics of isolated Fusarium species

(a) and (b): F. graminearum, (c), and (d): F. oxysporum,

and (f): F. proliferatum, (g), and (h): F. avenaceum, (i)

and (j): F. equiseti, (m) and (n): F. acuminatum, (o) and

(p): F. incarnatum and (k), (l): macroconidias, and (q):

chlamydospores.

Fusarium graminearum is a species that aects cereals (Parry et

al., 1995) and has been reported several times in Algerian elds by

Hadjout and Zouidi (2022), and Djaaboub et al. (2020). Fusarium

acuminatum and Fusarium equiseti are very common in Spain and

southern Europe (Marín et al., 2012); this last species was reported for

the rst time in Algeria by Bencheikh et al. (2020) on durum wheat.

As well as F. incarnatum by Bouanaka et al. (2023). F. oxysporum has

been reported several times worldwide, in the United States, Bulgaria,

Hungary, and Japan (Parry et al., 1995).

Conclusion

The results of the prospection of Fusarium head blight (FHB) at

the level of 142 and 120 barley and durum wheat elds, respectively,

during the two agricultural campaigns in the study region, made it

possible to map the spatial distribution of the disease and to evaluate

the prevalence, severity, and incidence of this disease. Additionally,

the results of the molecular analysis identify and characterize

seven Fusarium species with dierent proportions and classied in

descending order: F. equiseti (27.45 %), F. graminearum (25.49 %),

F. acuminatum (19.6 %), F. oxysporum (13.73 %), F. proliferatum (9.8

%) and nally F. avenaceum and F. incarnatum with 1.96 %. Finally,

the identication of F. oxysporum (accession number OR594284 and

PQ279785) and Fusarium proliferatum (accession number OR228993

and PQ301480) in Algerian cereal elds (barley and durum wheat)

has been reported for the rst time. It was observed that Fusarium

head blight (FHB) aects barley more than durum wheat because,

for barley, the conditions are favorable between fusarium head blight,

the vegetative stage (owering), and the climatic conditions of the

study region during two agricultural seasons in 2018-2019. It would

be desirable to expand the elds of prospection for this disease in

all areas of Eastern Algeria, to identify and characterize the species

of Fusarium spp., and to evaluate their pathogenicity on the most

cultivated varieties in these regions. Finally, identify and assess the

toxigenic potential of these fusarium species.

Literature cited

Abdallah-Nekache, N., Laraba, I., Ducos, C., Barreau, C., Bouznad, Z., &

Boureghda, H. (2019). Occurrence of Fusarium head blight and Fusarium

crown rot in Algerian wheat: identication of associated species and

assessment of aggressiveness. European Journal of Plant Pathology, 154,

499-512. https://doi.org/10.1007/s10658-019-01673-7

Alisaac, E., & Mahlein A. K. (2023).

Fusarium head blight on wheat: biology,

modern detection and diagnosis and integrated disease management.

Toxins, 15(3), 192. https://doi.org/10.3390/toxins15030192

Bartlett, J. M., & Stirling, D. (Eds.). (2003). PCR protocols (Vol. 226, pp. 3-525).

Totowa, NJ: Humana Press. https://doi.org/10.1385/1592593844

Bencheikh, A., Rouag, N., Boutalbi W., & Belabed I. (2018). First report of

Fusarium chlamydosporum causing crown rot and dumping of on Durum

wheat in Algeria. Journal of Novel Researches on Plant Protection, 9(4),

309-324. https://ppj.shiraz.iau.ir/article_671418.html?lang=en

Bencheikh, A., Rouag, N., Mamache, W., & Belabed, I. (2020). First report of

Fusarium equiseti causing crown rot and damping-o on durum wheat

in Algeria. Archives of Phytopathology and Plant Protection, 53(19-20),

915-931. https://doi.org/10.1080/03235408.2020.1804303

Bottalico, A., & Perrone, G. (2002). Toxigenic Fusarium species and mycotoxins

associated with head blight in small-grain cereals in Europe. In: Logrieco,

A., Bailey, J. A., Corazza, L., Cooke, B. M. (eds) Mycotoxins in Plant

Disease. Springer, Dordrecht. https://doi.org/10.1007/978-94-010-0001-

7_2

Bouanaka, H., Bellil, I., Benouchenne, D., Nieto, G., & Kheli, D. (2023). First

report of Fusarium asiaticum and Fusarium incarnatum in Algeria, and

evaluation of their pathogenicity on wheat crown rot. Bulgarian Journal

of Agricultural Science

, 29(5), 908-916. https://journal.agrojournal.org/

page/en/details.php?article_id=4411

Carbone, I., & Kohn, L. M. (1999). A method for designing primer sets for

speciation studies in lamentous ascomycetes. Mycologia, 91(3), 553-

556. https://doi.org/10.1080/00275514.1999.12061051

Djaaboub, S., Moussaoui, A., Meddah, B., Gouri, S., & Benyahia, K. (2020).

Prevalence of mycoora and Fusarium graminearum chemotype

DON in wheat in Bechar province of South-Western Algeria. Acta

Phytopathologica et Entomologica Hungarica, 55(1), 11-26. https://doi.

org/10.1556/038.55.2020.002

Djellouli, Y., Louail, A., Messner, F., Missaoui, K., & Gharzouli, R. (2020). Les

écosystèmes naturels de l’Est algérien face au risque du changement

climatique. Geo-Eco-Trop, 44(4), 609-621. https://www.geoecotrop.be/

uploads/publications/pub_444_08.pdf

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2025, 42(1): e254216 January-March. ISSN 2477-9409.

6-6 |

Gardes, M., & Bruns, T. D. (1993). ITS primers with enhanced specicity for

basidiomycetes‐application to the identication of mycorrhizae and

rusts. Molecular Ecology, 2(2), 113-118. https://doi.org/10.1111/j.1365-

294X.1993.tb00005.x

Glass, N. L., & Donaldson, G. C. (1995). Development of primer sets designed

for use with the PCR to amplify conserved genes from lamentous

ascomycetes. Applied and Environmental Microbiology, 61(4), 1323-

1330. https://doi.org/10.1128/aem.61.4.1323-1330.1995

Hadjout, S., & Zouidi, M. (2022). Morphological and cultural characterization

of two Fusarium isolates causing wheat Fusarium head blight in

Algeria. Notulae Scientia Biologicae, 14(4), 11318-11318. https://doi.

org/10.55779/nsb14411318

Laraba, I., Boureghda, H., Abdallah, N., Bouaicha, O., Obanor, F., Moretti, A.,

... & O’Donnell, K. (2017a). Population genetic structure and mycotoxin

potential of the wheat crown rot and head blight pathogen Fusarium

culmorum in Algeria. Fungal Genetics and Biology, 103, 34-41. https://

doi.org/10.1016/j.fgb.2017.04.001

Laraba, I., Keddad, A., Boureghda, H., Abdallah, N., Vaughan, M. M., Proctor, R.

H., … & O’Donnell, K. (2017b). Fusarium algeriense, sp. nov., a novel

toxigenic crown rot pathogen of durum wheat from Algeria is nested in

the Fusarium burgessii species complex. Mycologia, 109(6), 935–950.

https://doi.org/10.1080/00275514.2018.1425067

Leslie, J. F., Summerell, B. A., Bullock, S. (2006). The Fusarium laboratory

manual. Blackwell Publishers, Ames, Iowa, USA.

MADR, 2020. Ministère de l’agriculture et du développement durable de

l’Algérie. Statistiques. https://madr.gov.dz/

Ma, L. J., Geiser, D. M., Proctor, R. H., Rooney, A. P., O’Donnell, K., Trail,

F., ... & Kazan, K. (2013). Fusarium

pathogenomics. Annual Review

of Microbiology

, 67, 399-416. https://doi.org/10.1146/annurev-

micro-092412-155650

Marín, P., Moretti, A., Ritieni, A., Jurado, M., Vázquez, C., & González-Jaén,

M. T. (2012). Phylogenetic analyses and toxigenic proles of Fusarium

equiseti and Fusarium acuminatum isolated from cereals from Southern

Europe. Food Microbiology, 31(2), 229-237. https://doi.org/10.1016/j.

fm.2012.03.014.

Matny O. N. (2015). Fusarium head blight and crown rot on wheat & barley:

losses and health risks. Adv Plants Agric Res. 2

(1), 38–43. DOI: 10.15406/

apar.2015.02.00039

Moretti, A. N. (2009). Taxonomy of Fusarium genus: A continuous ght between

lumpers and splitters. Zbornik Matice srpske za prirodne nauke, 117, 7-13.

https://doi.org/10.2298/ZMSPN0917007M

Nelson, P. E., Toussoun T. A., & Marasas, W. F. O. (1983). Fusarium species: An

illustrated manual for identication. The Pennsylvania State Univ. Press,

University Park, PA. 193 pp.

Nganje, W. E., Bangsund, D. A., Leistritz, F. L., Wilson, W. W., & Tiapo, N. M.

(2004). Regional economic impacts of Fusarium head blight in wheat

and barley. Applied Economic Perspectives and Policy, 26(3), 332-347.

https://www.jstor.org/stable/3700805.

Osborne, L. E., & Stein, J. M. (2007). Epidemiology of Fusarium head blight on

small-grain cereals. International Journal of Food Microbiology, 119(1-

2), 103-108. https://doi.org/10.1016/j.ijfoodmicro.2007.07.032

Parry, D. W., Jenkinson, P. & McLeod, L. (1995). Fusarium ear blight (scab) in

small grain cereals - a review. Plant Pathology, 44, 207-238. https://doi.

org/10.1111/j.1365-3059.1995.tb02773.x

Sanger, F., Nicklen, S., & Coulson, A. R. (1977). DNA sequencing with chain-

terminating inhibitors. Proceedings of the National Academy of

Sciences

, 74(12), 5463-5467. https://www.pnas.org/doi/epdf/10.1073/

pnas.74.12.5463

Stack, R. W., & McMullen, M. P. (1998). A visual scale to estimate severity of

Fusarium head blight in wheat. https://library.ndsu.edu/ir/bitstream/

handle/10365/9187/PP1095_1998.pdf?sequence=1

Tedjari, N., Abbas, K., & Madani, T. (2014). Diagnostic des systèmes fourragers

dans la région semi-aride de Sétif. In: Chentouf M. (ed.), López-Francos

A. (ed.), Bengoumi M. (ed.), Gabiña D. (ed.). Technology creation and

transfer in small ruminants: roles of research, development services and

farmer associations. Zaragoza : CIHEAM / INRAM / FAO, 2014. p. 489-

493. (Options Méditerranéennes: Série A. Séminaires Méditerranéens ;

n. 108). 8. Seminar of the FAO-CIHEAM Sub-Network on Production

Systems, 2013/06/11-13, Tangier (Morocco). http://om.ciheam.org/om/

pdf/a108/00007672.pdf

Touati-Hattab, S., Barreau, C., Verdal-Bonnin, M. N., Chereau, S., Richard-

Forget, F., Hadjout, S., & Bouznad, Z. (2016). Pathogenicity and

trichothecenes production of Fusarium culmorum strains causing head

blight on wheat and evaluation of resistance of the varieties cultivated in

Algeria. European Journal of Plant Pathology, 145, 797-814. https://doi.

org/10.1007/s10658-016-0869-y

Venkataramana, M., Selvakumar, G., & Chandranayaka, S. (2018). Fusarium

mycotoxin: toxicity and detection. Microbial Toxins. Toxinology.

Springer, Dordrecht, 465-469. https://doi.org/10.1007/978-94-007-6725-

6_4-1

Wegulo, S. N., Baenziger, P. S., Nopsa, J. H., Bockus, W. W., & Hallen-Adams, H.

(2015). Management of Fusarium

head blight of wheat and barley. Crop

Protection

, 73, 100-107. https://doi.org/10.1016/j.cropro.2015.02.025

Yekkour, A., Toumatia, O., Meklat, A., Verheecke, C., Sabaou, N., Zitouni, A.,

& Mathieu, F. (2015). Deoxynivalenol-producing ability of Fusarium

culmorum strains and their impact on infecting barley in Algeria. World

Journal of Microbiology and Biotechnology, 31, 875-881. https://doi.

org/10.1007/s11274-015-1841-2

Zadoks, J. C., Chang, T. T., & Konzak, C. F. (1974). A decimal code for the growth

stages of cereals

. Weed Research, 14(6), 415-421. https://onlinelibrary.

wiley.com/doi/epdf/10.1111/j.1365-3180.1974.tb01084.x

Zahri, S., Farih, A., & Douira, A. (2014). Statut des principales maladies cryptoga-

miques foliaires du blé au Maroc en 2013. Journal of Applied Bioscien-

ces

, 77, 6543-6549. https://doi.org/10.4314/jab.v77i0.5

Zhang, K., Yuan-Ying, S., & Cai, L. (2013). An optimized protocol of single spore

isolation forfungi. Cryptogamie, Mycologie, 34(4), 349-356. https://

doi.org/10.7872/crym.v34.iss4.2013.349