Keywords:

Genotyping

Sus scrofa domesticus

Major genes

Allelic frequencies of genes associated with productive traits in western Mexican boars

Frecuencias alélicas de genes asociados a rasgos productivos en cerdos sementales del occidente de

México

Frequências alélicas de genes associados a características produtivas em cachaços do oeste Mexicano

Miguel Ayala-Valdovinos

Jorge Galindo-García

Theodor Duifhuis-Rivera

Néstor Michel-Regalado

Abraham Virgen-Méndez

Luís García-Sánchez

Rev. Fac. Agron. (LUZ). 2025, 42(1): e254208

ISSN 2477-9407

DOI: https://doi.org/10.47280/RevFacAgron(LUZ).v42.n1.VIII

Animal production

Associate editor: Dra. Rosa Razz

University of Zulia, Faculty of Agronomy

Bolivarian Republic of Venezuela

Departamento de Producción Animal, División de Ciencias

Veterinarias, Centro Universitario de Ciencias Biológicas y

Agropecuarias, Universidad de Guadalajara, Camino Ramón

Padilla Sánchez 2100, C. P. 44600. Nextipac, Zapopan,

Jalisco, México.

Received: 02-10-2024

Accepted: 21-12-2024

Published: 09-01-2025

Abstract

The ESR1, PRLR, and RYR1 genes have previously been

associated with traits of productive interest. The objective of this

study was to determine the allelic frequencies of genes associated

with productive traits in boars from pig farms in western Mexico.

A total of 140 boars of six breeds, Duroc, Hampshire, Landrace,

Piétrain, and Yorkshire, and Yorkshire/Landrace crosses were

sampled. The pigs were genotyped via polymerase chain reaction

(PCR) and restriction fragment length polymorphism (RFLP)

techniques. The two alleles of the ESR1 gene were identied in the

six breeds, but only BB homozygotes were recognized in Yorkshire

pigs (0.2) and their crosses (0.05). The A and B alleles of the PRLR

gene were distinguished in all the breeds studied, recognizing a

considerable variability in the allele frequencies. Due to the allelic

diversity and its eects evidenced in previous publications, it is

suggested to evaluate the association of each genotype with the

reproductive parameters to be improved in order to determine which

genotype is more relevant in each population. In the RYR1 gene,

the mutant allele causing PSS was found in all the breeds studied,

which can generate pigs with PSE meat. It is recommended that the

selection of boars of any breed to be used as breeders includes a

genotyping test. Knowing the genotypes in boars can be used as a

way to select better breeders.

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2025, 42(1): e254208 January-March. ISSN 2477-9407.

2-6 |

Resumen

Los genes ESR1, PRLR y RYR1 han sido previamente asociados

con rasgos de interés productivo. El objetivo de este estudio fue

determinar las frecuencias alélicas de genes asociados a rasgos

productivos en sementales de granjas porcícolas del Occidente

de México. Se muestrearon 140 sementales de seis razas: Duroc,

Hampshire, Landrace, Piétrain, Yorkshire y cruces (Yorkshire/

Landrace). Se genotipicó mediante las técnicas de reacción de

cadena de polimerasa (PCR) y polimorsmos de longitud de

fragmentos de restricción (RFLP). Se identicaron los dos alelos del

gen ESR1 en las seis razas, pero sólo se genotipicaron homocigotos

BB en cerdos Yorkshire (0,2) y sus cruces (0,05). Los alelos A y B del

gen PRLR se identicaron en todas las razas estudiadas reconociendo

una considerable variabilidad en las frecuencias alélicas. En razón a

la diversidad alélica y en sus efectos evidenciados en publicaciones

previas se sugiere evaluar la asociación de cada genotipo con los

parámetros reproductivos que se desean mejorar para determinar

que genotipo es más relevante en cada población. En el gen RYR1

se encontró el alelo mutante causante del PSS en todas las razas

estudiadas, lo que puede generar cerdos con carne PSE. Se recomienda

que la selección de sementales de cualquier raza que se utilizarán

como reproductores incluya un test de genotipicación. El conocer

los genotipos en cerdos sementales puede ser utilizado como una vía

para la selección de mejores reproductores.

Palabras clave: genotipicación, Sus scrofa domestica, genes

mayores

Resumo

Os genes ESR1, PRLR e RYR1 foram previamente associados

a características de interesse produtivo. O objetivo deste estudo

foi determinar as frequências alélicas de genes associados a

características produtivas em cachaços de granjas de suínos no

oeste do México. Um total de 140 cachaços de seis raças, Duroc,

Hampshire, Landrace, Piétrain e Yorkshire, e cruzamentos Yorkshire/

Landrace foram amostrados. Os porcos foram genotipados por meio

de técnicas de reação em cadeia da polimerase (PCR) e polimorsmo

de comprimento de fragmento de restrição (RFLP). Os dois alelos do

gene ESR1 foram identicados nas seis raças, mas apenas homozigotos

BB foram reconhecidos em porcos Yorkshire (0,2) e seus cruzamentos

(0,05). Os alelos A e B do gene PRLR foram distinguidos em todas

as raças estudadas, reconhecendo uma variabilidade considerável

nas frequências alélicas. Devido à diversidade alélica e seus

efeitos evidenciados em publicações anteriores, sugere-se avaliar a

associação de cada genótipo com os parâmetros reprodutivos a serem

melhorados, a m de determinar qual genótipo é mais relevante em

cada população. No gene RYR1, o alelo mutante causador da PSS foi

encontrado em todas as raças estudadas, o que pode gerar suínos com

carne PSE. Recomenda-se que a seleção de cachaços de qualquer

raça para serem utilizados como reprodutores inclua um teste de

genotipagem. Conhecer os genótipos em cachaços pode ser usado

como forma de selecionar melhores reprodutores.

Palavras-chave: genotipagem, Sus scrofa domesticus, genes

principais.

Introduction

The swine industry is very important at the global level since

pork represents the second-most consumed source of animal protein

in the world (Lebret and Čandek-Potokar, 2022). The development

of molecular genotyping techniques in pigs has accelerated genetic

progress and increased the precision of selection for productive

traits that are dicult to improve, such as fertility, weight gain,

meat quality, and disease resistance (Yin et al., 2024). Identifying

the polymorphisms associated with these desirable traits in dierent

breeds of pigs is essential for improving productive performance

in production systems (Tan et al., 2017). Some candidate genes

have been reported for their association with characteristics of

productive interest. Estrogen receptor 1 gene (ESR1) is involved in

the activation of the estrogen response in dierent tissues, including

the ovaries, uterus, pituitary gland, and mammary gland, which

modulate processes such as ovulation, pregnancy establishment, and

sexual receptivity (Muñoz et al., 2007). The ESR1 gene is located on

chromosome 1 of the pig genome, for which the PvuII polymorphism

with alleles A and B has been described (Rothschild et al., 1991).

Alleles A and B of this polymorphism have been associated with an

increase in the number of piglets born alive, revealing variability

in the dierent breeds of pigs studied (Drogemuller et al., 2001;

Goliášová and Wolf, 2004). Another gene of interest encodes the

prolactin receptor (PRLR), which is activated by the binding of

prolactin and has important functions in the formation of the corpus

luteum, progesterone synthesis, estrous cycle regulation, and milk

production (Sabev, 2019), which implies the importance of this gene

in the reproductive performance of sows. The PRLR gene is located

on chromosome 16 in region 16q2.2-2.3, and alleles A and B have

been described (Vincent et al., 1997). A positive eect of the AA

genotype has been shown, with an increase in the number of live-

born piglets (Rothschild et al. 1996; Kmieć et al., 2001). The gene

encoding ryanodine receptor 1 (RYR1), also known as the halothane

gene (hal) or porcine stress gene, plays a major role in the transport

of Ca

in muscle cells (Luerce et al., 2009). A transversion mutation

(C/T) at position 1,843 on chromosome 6 causes a change from an

arginine to a cysteine (Fujii et al., 1991). The heterozygous (Nn)

and homozygous mutant (nn) genotypes are susceptible to porcine

stress syndrome (PSS) or malignant hyperthermia, which leads to the

postmortem manifestation of pale, soft, and exudative meat (PSE)

(Houde et al., 1993). Genetic studies of boars in Mexico are scarce

because of multiple factors, such as restrictions due to the biosecurity

of pig farms, the rapid rotation of animals, and the low importance

given to analyzing gene tests. Genotyping by means of PCR-RFLP

oers the opportunity to identify genetic aptitudes in boars to choose

those that possess improvement-related polymorphisms for breeding

(Hernández-López et al., 2006). Therefore, the objective of this study

was to determine the allelic frequencies of genes ESR1, PRLR y RYR1

in boars from pig farms in western Mexico.

Materials and methods

Ethical statement

The study was carried out in accordance with the internal

regulations of bioethics of the University Center for Biological and

Agricultural Sciences, University of Guadalajara, Mexico No. CC/

CN 11-12/001/2012.

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Ayala-Valdovinos et al. Rev. Fac. Agron. (LUZ). 2025, 42(1): e254208

3-6 |

Collection of samples

The execution of the laboratory tests was carried out at the

Institute of Animal Biotechnology of the University of Guadalajara,

Camino Ramón Padilla Sánchez # 2100, Las Agujas, Zapopan,

Jalisco, Mexico. For this study, 140 samples of boars were taken

from dierent pig farms located in the western region of Mexico,

which is composed of temperate, mountainous, and humid tropic

agroecological zones. Among these pigs, 19 were of the Duroc breed,

eight were Hampshire, 13 were Landrace, 21 were Piétrain, 15 were

Yorkshire, and 64 were Yorkshire/Landrace crosses.

DNA extraction

Approximately 3 mL of peripheral blood was collected from

each animal in a vacutainer

tube with ethylenediaminetetraacetic

acid (EDTA) via puncture of the external jugular vein according to

NOM-060-SAG/ZOO-2020 (Secretaría de Agricultura y Desarrollo

Rural, 2020). DNA extraction was performed via the Quick-DNA™

Universal Kit (Zymo Research, USA).

PCR-RFLP

To perform DNA amplication, we used Thermo Scientic™

PCR kits (Takara Bio Inc., Japan) with a 20 μL reaction mixture

containing ~100 ng of blood lysate, 0.5 μL of DreamTaq® DNA

Polymerase, 2 μL of 1x PCR buer with 20 mM MgCl

, 1 μL of 10

mM dNTP mixture, and 5 pmol of both primers, with the remaining

volume consisting of double distilled water (ddH

O). Amplication of

the DNA fragments was carried out in a Techne® TC-5000 Thermal

Cycler (Techne Inc., USA) via the following PCR program: initial

denaturation for 5 min at 95 °C, followed by 35 cycles of 94 °C for 30

s, annealing for 30 s at the temperature listed for each gene in Table 1,

and extension at 72 °C for 30 s, with a nal extension at 72 °C for 5

min as described by Ayala-Valdovinos et al. (2017). For PCR-RFLP,

the primers and enzymes shown in table 1 were used to amplify the

regions of interest in ESR1, PRLR, and RYR1. The amplied products

were analyzed via 4% agarose gel electrophoresis, stained with Gel

Red (Biotium, Hayward, USA), and photographed under ultraviolet

light.

Estimation of genotype and allele frequencies for each gene

To estimate genotype and allele frequencies, we applied the direct

counting method (Baltian et al., 2011).

Results and discussion

In the present study, the 140 boars included in the research

were genotyped using the PCR-RFLP technique for the three

polymorphisms evaluated. The results indicated that the pig breeds in

the western region of Mexico presented dierent genotype and allelic

frequencies for each gene studied, as shown in table 2.

ESR1

The B allele is associated with a higher number of piglets per litter

(Drogemuller et al., 2001). Boars with the homozygous genotype BB

were found only in the Yorkshire breed and in Yorkshire/Landrace

hybrid pigs. The allelic frequency of Yorkshire boars found in our

study was A: 0.63 and B: 0.36, similar to that reported by Lemus-Flores

et al. (2009), who reported frequencies of A: 0.62 and B: 0.38; despite

the higher frequency of the A allele, the groups with a higher presence

of the B allele were the maternal lines (Lemus-Flores et al., 2009). In

the Yorkshire/Landrace hybrid pigs in our study, the A: 0.82 and B:

0.18 allele frequencies were similar to those reported by Rempel et al.

(2010) and Duifhuis-Rivera et al. (2019) of A: 0.79 and 0.62 and B:

0.21 and 0.37 in Yorkshire/Landrace/Duroc and Yorkshire/Landrace

crosses, respectively. The B allele has been reported more frequently

in Chinese breeds (Wu et al., 2006), so it is speculated that this allele

could have been introduced in some European breeds through crosses

with pigs of Chinese breeds (Rothschild et al., 1996).

The Landrace pigs included in the present study presented

frequencies of A: 0.88 and B: 0.11. These results coincide with those

reported by Kmieć et al. (2002), Wu et al. (2006) and Kapelański

et al. (2013), who reported frequencies of 0.94, 0.87, and 0.93 for

allele A and 0.06, 0.13, and 0.07 for allele B, respectively. The low

presence of the B allele in Landrace in this study as in other previous

studies, could be explained because the A allele has been associated

to improve some reproductive performance traits of boars (Terman et

al., 2006), which by the selection of these traits, could consequently

decrease the frequency of the B allele. The allelic frequencies for

Piétrain pigs found in our study (A: 0.81 and B: 0.19) are similar

to those reported by Gunawan et al. (2011) and Hunyadi-Bagi et al.

(2016); the frequencies were equal in both studies, with values of 0.90

and 0.10 for alleles A and B, respectively.

Table 1. The primers used for the genotyping of ESR1, PRLR and RYR1.

Gen

Primers

(5´-3´)

(°C)

PCR product

(bp)

RE Reference

ESR1

F- GACAGCTTCCCTGCAGATTC

R- TTCATCATGCCCACTTCGTA

55 °C

BB: 55, 65

AB: 55, 65, 120

AA: 120

PvuII Drogemuller et al. (2001)

PRLR

F-CGTGGCTCCGTTTGAAGAACC

R-CTGAAAGGAGTGCATAAAGCC

57 °C

BB: 104, 59

AB: 104, 85, 59, 19

AA: 85, 59, 19

AluI Drogemuller et al. (2001)

RYR1

F-CCACACCCTCCCCGCAAGTGC

R-GCCAGGGAGCAAGTTCTCAGTAAT

58 °C

NN: 95, 49

Nn: 144, 95, 49

nn: 144

HhaI Luerce et al. (2009)

F = forward, R = reverse, RE = restriction enzyme, Tm = annealing temperature

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2025, 42(1): e254208 January-March. ISSN 2477-9407.

4-6 |

Table 2. Genotype and allelic frequencies of the ESR1, PRLR, and RYR1 genes.

Gene Breed No

Genotypic frequency (No) Allelic F.

AA AB BB A B

ESR1

Duroc 19 0.95 (18) 0.05 (1) 0 (0) 0.97 0.03

Hampshire 8 0.88 (7) 0.13 (1) 0 (0) 0.95 0.07

Landrace 13 0.77 (10) 0.23 (3) 0 (0) 0.88 0.11

Piétrain 21 0.62 (13) 0.38 (8) 0 (0) 0.81 0.19

Yorkshire 15 0.47 (7) 0.33 (5) 0.2 (3) 0.63 0.36

Crosses 64 0.69 (44) 0.27 (17) 0.05 (3) 0.82 0.18

Gene Breed No

AB BB A B

PRLR

Duroc 19 0.47 (9) 0.47 (9) 0.05 (1) 0.70 0.29

Hampshire 8 0.38 (3) 0.38 (3) 0.25 (2) 0.57 0.44

Landrace 13 0.23 (3) 0.62 (8) 0.15 (2) 0.54 0.46

Piétrain 21 0.57 (12) 0.33 (7) 0.1 (2) 0.74 0.27

Yorkshire 15 0 (0) 0.47 (7) 0.53 (8) 0.24 0.77

Crosses 64 0.22 (14) 0.53 (34) 0.25 (16) 0.49 0.52

Gene Breed No

Nn nn N n

RYR1

Duroc 19 0.89 (17) 0.11 (2) 0 (0) 0.95 0.06

Hampshire 8 0.62 (5) 0.38 (3) 0 (0) 0.81 0.19

Landrace 13 0.92 (12) 0.08 (1) 0 (0) 0.96 0.04

Piétrain 21 0.29 (6) 0.52 (11) 0.19 (4) 0.55 0.45

Yorkshire 15 0.93 (14) 0.07 (1) 0 (0) 0.97 0.03

Crosses 64 0.73 (47) 0.22 (14) 0.05 (3) 0.84 0.16

No = Number of animals. F = Frequency

The allelic frequencies of the Duroc pigs in our study (A: 0.97 and

B: 0.03) dier from those reported by Short et al. (1997) and Hunyadi-

Bagi et al. (2016), where no pigs carrying the B allele were found. In

terminal line boars, the B allele was found to have low frequencies,

this could be due to a selection directed at the reproductive traits of

the boar, because the ESR1 gene is important in the initiation and

maintenance of spermatogenesis. Terman et al., (2006) obtained

similar frequencies in a population of Duroc x Pietrain boars A: 0.84

and B: 0.16, where the A allele is more common, since it is associated

with ejaculates of greater volume, motility and concentration.

PRLR

The three genotypes for the PRLR gene were identied in the

dierent breeds studied, with the exception of the homozygous AA

genotype, which was not observed in Yorkshire pigs. In the case of

the Duroc, Hampshire, Landrace and Piétrain breeds, the A allele

presented the highest allele frequency, with values of 0.70, 0.57, 0.54,

and 0.74, respectively. The highest frequency of allele A found is in line

with the results reported by Vincent et al. (1998), in Duroc (A: 0.79)

and Landrace pigs (A: 0.72); Drogemuller et al. (2001), in Duroc pigs

(A: 0.82); Kmieć and Terman (2006), in Piétrain (A: 0.72), Duroc/

Piétrain hybrid (A: 0.65), and Hampshire/Piétrain hybrid (A: 0.83)

pigs. In contrast to the previous data, in the Yorkshire and hybrid pigs

in our study, a higher frequency of the B allele was observed, with

values of 0.77 and 0.52, respectively. These results agree with those

reported by Vincent et al. (1998) in Yorkshire pigs (B: 0.63); Menčik

et al. (2015) in Landrace/Large White hybrid pigs (B: 0.73). The

AA genotype is associated with an increase in the number of piglets

born and live-born piglets per litter (Vincent et al., 1998; Kmieć et

al., 2001; Alonso et al., 2003; Epishko et al., 2009). In contrast, in

dierent populations of pigs with the BB genotype, an increase in the

number of live-born piglets has been reported (Mihailov et al., 2014;

Menčik et al., 2015). The Yorkshire is a prolic breed, where it could

be suggested that the frequency of the AA genotype would be higher,

but there are studies where the BB genotype was associated with the

best reproductive traits in pigs. The participation of the PRLR gene

in a selection process as a marker should preferably be accompanied

by the study of the relationship of the genotypes with the traits of

the pigs that are desired to be improved, to determine which allele

has an improving eect in each population (Mihailov et al., 2014).

Inconsistencies have been described in other genes associated with

reproductive traits between which variant is improving or not, and

this does not detract from the eect of the dierent genotype in each

population; the variations can be attributed to environmental, genetic,

sample size and age dierences (Rempel et al., 2010). In boars with the

heterozygous genotype AB, an increase in the volume, concentration,

and number of live spermatozoa per ejaculate was reported (Kmieć

and Terman, 2006). Due to the variability in allele frequencies and the

dierent eects described for the PRLR genotypes, it is suggested to

identify which of the genotypes has the best eect on the reproductive

traits of each population being investigated (Sabev, 2019).

RYR1

In many countries, genotyping for the RYR1 gene mutation is

mandatory. There is evidence that the RYR1 sensitivity allele (n)

has a great inuence on the pH fall observed in PSE (pale, soft

and exudative) meats. In pigs PSE meat is a major quality defect

associated with abnormal post-mortem muscle acidication, usually

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Ayala-Valdovinos et al. Rev. Fac. Agron. (LUZ). 2025, 42(1): e254208

5-6 |

occurs in pigs that are genetically sensitive to stress when subjected to

acute pre-slaughter stressors immediately prior to slaughter (Guàrdia

et al., 2004). All boars with PSS must be eliminated from breeding

schemes, as a result worldwide, selection against the RYR1 gene

mutation has decreased its frequency in some breeds (Kamiński et al.,

2002). The presence of the mutant allele n of PSS was identied in

the dierent breeds included in the present study. The frequencies of

this allele found in the Duroc (n: 0.06), Landrace (n: 0.04), Yorkshire

(n: 0.03), and Hampshire (n: 0.19) breeds in our study are similar

to those reported by Fujii et al. (1991) in Yorkshire pigs (n: 0.08);

those reported by Houde et al. (1993) in Duroc (n: 0.03), Landrace

(n: 0.15), and Yorkshire (n: 0.1) pigs, and those reported by O’Brien

(1993) in Duroc (n: 0.07), Landrace (n: 0.18), Yorkshire (n: 0.09),

and Hampshire (n: 0.07) pigs. The boars of the Piétrain breed in

our study presented the highest frequency of the mutant allele (n:

0.45). Among the boars of this breed, four pigs were found to be

homozygous n/n. These results are consistent with those reported by

O’Brien et al. (1993), who reported a frequency of 0.70 in Piétrain

pigs from the USA. Reports of the frequency of this mutation in

Mexico are scarce; Riojas-Valdés et al. (2005) and Davalos-Aranda

et al. (2010) reported frequencies of n: 0.29 and 0.13, respectively,

in hybrid pigs from dierent farms in northern Mexico. The high

frequency of the allele found in the Piétrain pigs in our study may

be due to the origin of the mutation, which was detected for the rst

time in Piétrain pigs, since breeds with outstanding characteristics

tend to have a higher incidence of carriers via a greater demand for

the production of lean meat without considering its quality (Monin et

al., 1981). The presence of the mutant allele in the other breeds in our

study, even those classied as maternal lines, is possible because it is

known from genotypic analysis that the mutation arose from a single

founder animal and has been previously identied in breeds such as:

Landrace, Yorkshire, Duroc, Poland China (Fujii et al., 1991). The

results of this study conrm that all breeds of boars have the potential

to carry the mutation causing PSS and generate pigs with PSE meat,

so genotyping could be a useful test before introducing any boar or its

genetics to a new population.

Conclusions

In the present study, the polymorphisms of three genes associated

with traits of economic importance were genotyped in boars from the

state of Jalisco, Mexico. Two alleles of the ESR1 gene were identied

in all six breeds, but only in Yorkshire pigs and crosses were BB

homozygous pigs identied. Alleles A and B of the PRLR gene were

identied in all the studied breeds, and owing to the variability in

allelic frequency and the diversity of the eects previously described

for the three genotypes of this gene, we suggest that when this

polymorphism is selected, the association of each genotype with

the prolicacy parameters that are desired to be improved should

be evaluated, and therefore, the relevant favorable genotype should

be determined. For the RYR1 gene, which causes PSS, the results of

this study indicate the presence of the mutant allele in all the breeds

studied. The Piétrain breed has a higher frequency than other breeds,

although their mutation frequency is low, we would suggest that the

selection of animals to be used as breeders includes the identication

of carrier and aected pigs, with the aim of eradicating this disease

from the swine population in Mexico.

Acknowledgments

This work was supported by the University of Guadalajara

through the Research Development project of the Department of

Animal Production (grant number P3E-270377.).

Literature cited

Alonso, V., Santana, B. A. A., Pirage Junior, W., Goulart, L. R., Diniz, H. da S.,

Machaim, M. F., & Borges, G. S. N. (2003). Eect of prolactin receptor

gene on the quantitative characteristics of economic interest on pigs.

Brazilian Journal of Veterinary Research and Animal Science, 40(5), 366-

372. https://doi.org/10.1590/S1413-95962003000500008

Ayala-Valdovinos, M. A., Galindo-García, J., Sánchez-Chiprés, D., & Duifhuis-

Rivera, T. (2017). Genotyping of friesian horses to detect a hydrocephalus-

associated c. 1423C> T mutation in B3GALNT2 using PCR-RFLP

and PCR-PIRA methods: frequency in stallion horses in Mexico.

Molecular and Cellular Probes, 32, 69-71. https://doi.org/10.1016/j.

mcp.2016.12.005

Baltian, L. R., Ripoli, M. V., Aida, Y., Takeshima, S., & Giovambattista, G.

(2011). Estimación de las frecuencias alélicas del gen BoLA-DRB3 en

una población de ganado Holstein de La Pampa mediante secuenciación

directa. Ciencia Veterinaria, 13(1), 66-69. https://cerac.unlpam.edu.ar/

index.php/veterinaria/article/view/1864

Davalos-Aranda, G., Maldonado-Mena, R., Garza-Zermeno, M. V., Cedillo-

Rosales, S., Galan-Alejo, L. C., & Riojas-Valdés, V. M. (2010).

Association among ryanodyn receptor and insulin-like growth factor

genes with production traits in a commercial type swine population from

Mexico. Journal of Animal and Veterinary Advances, 9(3), 639-642.

https://www.cabidigitallibrary.org/doi/full/10.5555/20103116287

Drogemuller, C., Hamann, H., & Distl, O. (2001). Candidate gene markers for

litter size in dierent german pig lines. Journal of Animal Science, 79(10),

2565-2570.

https://doi.org/10.2527/2001.79102565x

Duifhuis-Rivera, T., Ayala-Valdovinos M. A., Sanchez-Chiprez, D. R., Galindo-

Garcia J., Mejia-Martinez, K., Lemus-Avalos, G., Segura-Correa J. C.,

& Lemus-Flores C. (2019). Association of ESR1, FUT1, LEP and PRLR

genes with some productive traits of yorkshire-landrace sows in Mexico.

Journal of Animal and Veterinary Advances, 18(4), 132-138. https://doi.

org/10.36478/javaa.2019.132.138

Epishko, O. A., Epishko, T. I., & Kalashnikova, L. A. (2009). Polygenic character

of determination of reproductive traits of Belarus meat-type pig breed.

Russian Agricultural Sciences, 35(2), 118-120. https://doi.org/10.3103/

S1068367409020165

Fujii, J., Otsu, K., Zorzato, F., De Leon, S., Khanna, V. K., Weiler, J. E., O’Brien,

P.J., & MacLennan, D. H. (1991). Identication of a mutation in porcine

ryanodine receptor associated with malignant hyperthermia. Science,

253(5018), 448-451. https://doi.org/10.1126/science.1862346

Goliášová, E., & Wolf, J. (2004). Impact of the ESR gene on litter size and

production traits in Czech large white pigs. Animal Genetics, 35(4), 293-

297. https://doi.org/10.1111/j.1365-2052.2004.01155.x

Guàrdia, M. D., Estany, J., Balasch, S., Oliver, M. A., Gispert, M., & Diestre, A.

(2004). Risk assessment of PSE condition due to pre-slaughter conditions

and RYR1 gene in pigs. Meat Science, 67(3), 471-478. https://doi.

org/10.1016/j.meatsci.2003.11.020

Gunawan, A., Kaewmala, K., Uddin, M. J., Cinar, M. U., Tesfaye, D., Phatsara,

C., Tholen, E., Looft, C., & Schellander, K. (2011). Association study and

expression analysis of porcine ESR1 as a candidate gene for boar fertility

and sperm quality. Animal Reproduction Science, 128(1-4), 11-21. https://

doi.org/10.1016/j.anireprosci.2011.08.008

Hernández-López, S. H., Lemus-Flores, C., Alonso-Morales, R., & Herrera-

Haro, J. G. (2006). Efecto de genes candidatos sobre características

reproductivas de hembras porcinas. Revista Cientíca, 16(6), 648-654.

https://www.redalyc.org/pdf/959/95916612.pdf

Houde, A., Pommier, S. A., & Roy, R. (1993). Detection of the ryanodine receptor

mutation associated with malignant hyperthermia in purebred swine

populations. Journal of Animal Science, 71(6), 1414-1418. https://doi.

org/10.2527/1993.7161414x

Hunyadi-Bagi, Á., Balogh, P., Nagy, K., & Kusza, S. (2016). Association and

polymorphism study of seven candidate genes with reproductive traits in

three pig breeds in Hungary. Acta Biochimica Polonica, 63(2), 359-364.

https://doi.org/10.18388/abp.2015_1188

Kamiński, S., Ruść, A., & Wojtasik, K. (2002). Simultaneous identication of

ryanodine receptor 1 (RYR1) and estrogen receptor (ESR) genotypes

with the multiplex PCR-RFLP method in Polish Large White and Polish

Landrace pigs. Journal of Applied Genetics, 43(3), 331-336. https://

pubmed.ncbi.nlm.nih.gov/12177522/

Kapelański, W., Eckert, R., Jankowiak, H., Mucha, A., Bocian, M., & Grajewska,

S. (2013). Polymorphism of ESR, FSHß, RBP4, PRL, OPN genes and

their inuence on morphometric traits of gilt reproductive tract before

sexual maturity. Acta Veterinaria Brno, 82(4), 369-374. https://doi.

org/10.2754/avb201382040369

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2025, 42(1): e254201 January-March. ISSN 2477-9407.6-6 |

Kmieć, M., Dybus, A., & Terman, A. (2001). Prolactin receptor gene polymorphism

and its association with litter size in Polish landrace. Archives Animal

Breeding, 44(5), 547-552. https://doi.org/10.5194/aab-44-547-2001

Kmieć, M., Drovak, J., Vrtkova, I. (2002). Study on a relation between estrogen

receptor (ESR) gene polymorphism and some pig reproduction

performance characters in Polish landrace breed. Czech Journal of

Animal Science, 47(5), 1212-1819. https://www.researchgate.net/

publication/266470915_Study_on_a_relation_between_estrogen_

receptor_ESR_gene_polymorphism_and_some_pig_reproduction_

performance_characters_in_Polish_Landrace_breed

Kmieć, M., & Terman, A. (2006). Associations between the prolactin receptor

gene polymorphism and reproductive traits of boars. Journal of Applied

Genetics, 47(2), 139-141. https://doi.org/10.1007/BF03194613

Lebret, B., & Čandek-Potokar, M. (2022). Pork quality attributes from farm to

fork. Part II. Processed pork products. Animal, 16, 100383. https://doi.

org/10.1016/j.animal.2021.100383

Lemus-Flores, C., Mejia-Martinez, K., Rodriguez-Carpena, J. G., Barreras-

Serrano, A., Herrera-Haro, J. G., & Alonso-Morales, R. (2009). Genetic

diversity and variation of ESR, RBP4 and FUT1 genes in Mexican creole

and yorkshire pig populations. Journal of Biological Sciences, 9(8), 878-

883. https://doi.org/10.3923/jbs.2009.878.883

Luerce, T. D., Galli, V., Cerqueira, G. M., Simionatto, S., & Dellagostin, O.

A. (2009). An improved method for characterization of the mutation

associated to porcine stress syndrome by PCR amplication followed

by restriction analysis. Ciência Rural, 39(5), 1577-1580. https://doi.

org/10.1590/S0103-84782009000500044

Menčik, S., Vuković, V., Modrić, M., Špehar, M., Ostović, M., Sušić, V.,

Štoković, I., Samardžija, M., & Kabalin, A. E. (2015). PRLR- AluI gene

polymorphism and litter size traits in highly prolic line of topigs 20

sows. Acta Veterinaria, 65(4), 463-476. https://doi.org/10.1515/acve-

2015-0039

Mihailov, N. V., Usatov, A. V., Getmantseva, L. V., & Bakoev, S. U. (2014).

Associations between PRLR/AluI gene polymorphism with reproductive,

growth, and meat traits in pigs. Cytology and Genetics, 48(5), 323-326.

https://doi.org/10.3103/S0095452714050053

Monin, G., Sellier, P., Ollivier, L., Goutepongea, R., & Girard, J.P. (1981).

Carcass characteristics and meat quality of halothane positive and

halothane negative Piétrain pigs. Meat Science, 5(6), 413-423. https://doi.

org/10.1016/0309-1740(81)90040-1

Muñoz, G., Ovilo, C., Estellé, J., Silió, L., Fernández, A., & Rodriguez, C. (2007).

Association with litter size of new polymorphisms on ESR1 and ESR2

genes in a Chinese-European pig line. Genetics Selection Evolution,

39(2), 195. https://doi.org/10.1186/1297-9686-39-2-195

O’Brien, P. J., Shen, H., Cory, C. R., & Zhang, X. (1993). Use of a DNA-based

test for the mutation associated with porcine stress syndrome (malignant

hyperthermia) in 10,000 breeding swine. Journal of the American

Veterinary Medical Association, 203(6), 842-851. https://doi.org/10.2460/

javma.1993.203.06.0842

Rempel, L. A., Nonneman, D. J., Wise, T. H., Erkens, T., Peelman, L. J., &

Rohrer, G. A. (2010). Association analyses of candidate single nucleotide

polymorphisms on reproductive traits in swine. Journal of Animal

Science, 88(1), 1-15. https://doi.org/10.2527/jas.2009-1985

Riojas-Valdés, V. M., Canales-Zambrano, J. C., Gómez-de la Fuente, J. C.,

Dávalos-Aranda, G., Hernández-Vidal, G., & Salinas-Meléndez, J. A.

(2005). Allele frequency of porcine stress syndrome in Nuevo Leon by

PCR-RFLP analysis. Veterinaria México, 36(3), 261-267. https://www.

redalyc.org/articulo.oa?id=42336302

Rothschild, M. F., Larson, R. G., Jacobson, C., & Pearson, P. (1991). PvuII

polymorphisms at the porcine oestrogen receptor locus (ESR). Animal

Genetics, 22(5), 448. https://doi.org/10.1111/j.1365-2052.1991.tb00715.x

Rothschild, M., Jacobson, C., Vaske, D., Tuggle, C., Wang, L., Short, T., Eckardt,

G., Sasaki, S., Vincent, A., McLaren, D., Southwood, O., Van der

Steen, H., Mileham, A., & Plastow, G. (1996). The estrogen receptor

locus is associated with a major gene inuencing litter size in pigs.

Proceedings of the National Academy of Sciences, 93(1), 201-205. https://

doi.org/10.1073/pnas.93.1.201

Sabev, Z. (2019). Prolactin receptor gene (PRLR) role in swine reproduction. Trakia

Journal of Sciences, 17(1), 75. https://doi.org/10.15547/tjs.2019.01.012

Secretaría de Agricultura y Desarrollo Rural. (2020). NOM-060-SAG/ZOO-2020:

Especicaciones zoosanitarias para la transformación de despojos

animales y su empleo en la alimentación animal. https://www.dof.gob.

mx/nota_detalle.php?codigo=5663772

Short, T. H., Rothschild, M. F., Southwood, O. I., McLaren, D. G., De Vries,

A., Van der Steen, H., Eckardt, G. R., Tuggle, C. K., Helm, J., Vaske,

D. A., Mileham, A. J., & Plastow, G. S. (1997). Eect of the estrogen

receptor locus on reproduction and production traits in four commercial

pig lines. Journal of Animal Science, 75(12), 3138-3142. https://doi.

org/10.2527/1997.75123138x

Tan, C., Bian, C., Yang, D., Li, N., Wu, Z. F., & Hu, X. X. (2017). Application of

genomic selection in farm animal breeding. Yi Chuan, 39(11), 1033-1045.

https://doi.org/10.16288/j.yczz.17-286

Terman, A., Kmieć, M., & Polasik, D. (2006) Estrogen receptor gene (ESR) and

semen characteristics of boars. Archives Animal Breeding, 49(1), 71–76.

https://doi.org/10.5194/aab-49-71-2006

Vincent, A. L., Wang LizBen, W. L., Tuggle, C. K., Robic, A., & Rothschild, M.

F. (1997). Prolactin receptor maps to pig chromosome. Mammalian 8,

793–794. https://doi.org/10.1007/s003359900576

Vincent, A. L., Tuggle, C. K., Rothschild, M. F., Evans, G., Short, T. H.,

Southwood, O. I., & Plastow, G. S. (1998). The prolactin receptor gene

is associated with increased litter size in pigs. Proceedings 6th World

Congress on Genetics Applied to Livestock Production, 27, 15–18. https://

www.extension.iastate.edu/pages/ansci/swinereports/asl-1487.pdf

Wu, Z.F., Liu, D.W., Wang, Q.L., Zeng, H. Y., Chen, Y. S., & Zhang, H. (2006).

Study on the association between estrogen receptor gene (ESR) and

reproduction traits in Landrace pigs. Acta Genetica Sinica, 33(8), 711-

716. https://doi.org/10.1016/S0379-4172(06)60103-0

Yin, C., Zhou, P., Wang, Y., Yin, Z., & Liu, Y. (2024). Using genomic selection to

improve the accuracy of genomic prediction for multi-populations in pigs.

Animal, 18(2), 101062. https://doi.org/10.1016/j.animal.2023.101062