Keywords:

Soybean grain

Lipoxygenase

Lox genes

Single nucleotide polymorphisms

Molecular variation of lipoxygenase-associated genes in grain of commercial Mexican soybean

cultivars

Variación molecular de genes asociados a lipoxigenasas en grano de variedades de soya comercial

mexicana

Variação molecular de genes associados a lipoxigenases em grãos de variedades comerciais de soja

mexicana

Mónica López Fernández

Ana María Sifuentes Rincón

Francisco Alejandro Paredes Sánchez

Nicolás Maldonado Moreno

Homar Rene Gill Langarica

Rev. Fac. Agron. (LUZ). 2024, 41(2): e244111

ISSN 2477-9407

DOI: https://doi.org/10.47280/RevFacAgron(LUZ).v41.n2.01

Crop production

Associate editor: Dr. Jorge Vilchez-Perozo

University of Zulia, Faculty of Agronomy

Bolivarian Republic of Venezuela

Laboratorio de Biotecnología Vegetal, Centro de

Biotecnología Genómica, Instituto Politécnico Nacional,

Reynosa, Tamaulipas, México.

Laboratorio de Biotecnología Animal, Centro de

Biotecnología Genómica, Instituto Politécnico Nacional,

Reynosa, Tamaulipas, México.

Universidad Autónoma de Tamaulipas. IA-UAM, Mante,

Tamaulipas, México.

INIFAP-Campo Experimental Las Huastecas. Carretera

Tampico-Mante, km 55. Villa Cuauhtémoc, Altamira,

Tamaulipas, México.

Received: 19-01-2024

Accepted: 28-02-2024

Published: 18-03-2024

Abstract

Lipoxygenase enzymes encoded by the Lox1, Lox2 and Lox3 genes

play a crucial role in soybean grain, particularly in the development of o-

avors. Understanding molecular variation within Lox genes is essential

for the improvement of soybean organoleptic traits. This study investigated

the genetic variation in the internal regions of the Lox1, Lox2, and Lox3

genes in mature grain of commercially grown soybean cultivars in Mexico.

Genomic DNA from a diverse panel of Mexican soybean cultivars was

analyzed using resequencing techniques and in-silico analysis. Single

nucleotide polymorphisms (SNP) within the Lox1, Lox2, and Lox3 genes

were identied and characterized. The ndings indicated that Lox3 gene

displayed lower genetic variability compared to Lox1 and Lox2 genes,

specically, was identied a total of 26 SNPs in the Lox1 gene, 11 SNPs in

the Lox2 gene, and 5 SNPs in the Lox3 gene among the examined cultivars.

A non-synonymous SNP variant of the C/C genotype located in exon 6 of the

Lox2 gene was associated with a destabilizing eect on the lipoxygenase 2

enzyme in the Guayparime S-10 and Huasteca 300 cultivars. These ndings

provide insights into the molecular variation of lipoxygenase-associated

genes in Mexican soybean cultivars.

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2024, 41(2): e244111 April-June. ISSN 2477-9407.2-7 |

Resumen

Las enzimas lipoxigenasas codicadas por los genes Lox1, Lox2 y

Lox3 desempeñan un papel crucial en el grano de soya, particularmente

en el desarrollo de sabores desagradables. Comprender la variación

molecular dentro de los genes Lox es esencial para el mejoramiento

de las características organolepticas de la soya. Este estudio investigó

la variación genética en las regiones internas de los genes Lox1,

Lox2 y Lox3 en grano maduro de variedades de soya cultivados

comercialmente en México. Se analizó el ADN genómico de un

panel diverso de variedades de soya mexicanas mediante técnicas de

resecuenciación y análisis in silico. Se identicaron y caracterizaron

polimorsmos de un solo nucleótido (SNP) dentro de los genes Lox1,

Lox2 y Lox3. Los hallazgos indicaron que el gen Lox3 mostró una

menor variabilidad genética en comparación con los genes Lox1

y Lox2; especícamente, fueron identicados un total de 26 SNPs

en el gen Lox1, 11 SNPs en el gen Lox2 y 5 SNPs en el gen Lox3

entre las variedades examinadas. Un SNP no sinónimo variante del

genotipo C/C ubicado en el exón 6 del gen Lox2, fue asociado con un

efecto desestabilizador en la enzima lipoxigenasa 2 en las variedades

Guayparime S-10 y Huasteca 300. Estos hallazgos proporcionan

información sobre la variación molecular de los genes asociados a las

lipoxigenasas en variedades de soya mexicanas.

Palabras clave: grano de soya, lipoxigenasa, genes Lox, polimorsmos

de un solo nucleotido.

Resumo

As enzimas lipoxigenases codicadas pelos genes Lox1, Lox2 e

Lox3 desempenham um papel crucial na grão de soja, particularmente

no desenvolvimento de sabores estranhos. Compreender a variação

molecular dentro dos genes Lox é essencial para a melhoria das

características organolépticas da soja. Este trabalho visou pesquisar

a variação genética nas regiões internas dos genes Lox1, Lox2 e Lox3

em grãos maduros de variedades de soja cultivadas comercialmente no

México. O DNA genômico de um painel diversicado de variedades

mexicanas de soja foi analisado usando técnicas de ressequenciamento

e análise in silico. Foram identicados y caracterizados polimorsmos

de nucleotídeo único (SNP) nos genes Lox1, Lox2 e Lox3. Os

resultados indicaram que o gene Lox3 apresentou menor variabilidade

genética em comparação com os genes Lox1 e Lox2, especicamente,

um total de 26 SNPs no gene Lox1, 11 SNPs no gene Lox2 e 5 SNPs

no gene Lox3 foram identicados entre as variedades examinadas.

Uma variante SNP não-sinônima do genótipo C/C localizada no

exon 6 do gene Lox2 foi associada a um efeito desestabilizador na

enzima lipoxigenase 2 nas variedades Guayparime S-10 e Huasteca

300. Estes interesantes ressultados proporcionam informações sobre

a variação molecular dos genes associadas a lipoxigenases nas

variedades mexicanas de soja.

Palabras-chave: grão de soja, lipoxigenase, genes Lox, polimorsmos

de nucleotídeo único.

Introduction

Soybean grain [Glycine max (L.) Merr.] is globally recognized

for its signicance as a protein and oil source in human diets and as a

balanced animal feed (Singh et al., 2020). However, the consumption

of soybean products is limited due to the presence of anti-nutritional

compounds like lipoxygenase enzymes that trigger volatile

compound reactions, resulting in unpleasant avors in commercial

soybean-based products (Carpentieri-Pipolo et al., 2021). The

lipoxygenases facilitate the oxidation of polyunsaturated fatty acids

such as linoleic acid (18:2) and α-linolenic acid (18:3), resulting in

the production of hydroperoxides of unsaturated fatty acids (Lenis

et al., 2010). The enzymatic activity of soybean lipoxygenases has

signicance, particularly in relation to the generation of undesirable

avors during grain processing (Wang et al., 1994; Lee et al., 2014).

The Lox (lipoxygenase) loci play a crucial role in the expression

of the three known lipoxygenase genes in mature soybean grains,

these genes are located in three specic genomic regions. Lox1

(Glyma13g347600; GmLox1) and Lox2 (Glyma13g347500;

GmLox2) genes are found on chromosome 13, while the Lox3 gene

(Glyma13g026300; GmLox3) is located on chromosome 15 (Shin

et al., 2012). The structural composition of all three Lox genes

consists of nine exons and eight introns (Reinprecht et al., 2011).

The Lox2 gene is primarily responsible for the undesirable beany

avor in mature soybean grains (Davies et al., 1987). In past years,

research on lipoxygenases has focused on identifying natural soybean

mutants and generating single, double and triple null mutants through

mutagenesis that lack lipoxygenase activity (Suda et al., 1995; Lenis

et al., 2010). Conventional genetic improvement techniques have

also allowed breeders to develop lines and cultivars that exhibit a

null eect of lipoxygenases (Lee et al., 2014). In Mexico, soybean

production takes place at latitudes below 25° North with the soybean

plant adapted to short-day photoperiods of approximately 13.3 light

hours (Hinson and Hartwig, 1977). In Mexico, commercial soybeans

are grown in states such as Sonora, Sinaloa, and Tamaulipas and are

produced under a seasonal production system. The productive zones

of Sonora and Sinaloa are classied as the Mexican dry tropics, while

the southern zone of Tamaulipas and some coastal states are known

as the Mexican humid tropics. Both dry and humid tropics, have their

own genetic plant breeding program (Ascencio and Maldonado, 1998)

aimed at developing cultivars with high grain yield and tolerance to

pathogens (Maldonado and Ascencio, 2012; Rodríguez-Cota et al.,

2017). It is worth noting that Mexican soybean genetic programs

employ radiation with cobalt-60 to generate genetic variation during

the improvement process (Rodríguez-Cota et al., 2017). The objective

of this study was to investigate the genetic variability of Lox genes

through resequencing and in silico analysis in a Mexican soybean

population, alongside soybean materials devoid of the inuence of

lipoxygenases.

Materials and methods

In this study, a total of 13 soybean materials were analyzed.

Among them, 11 cultivars are commercially available cultivars and

they were developed in Mexico by the National Institute of Forestry,

Agriculture, and Livestock Research (INIFAP) to suit the conditions

of the Mexican humid and dry tropics. The Huasteca-named cultivars,

along with Tamesi and Vernal cultivars, were generously donated by

MSc. Nicolás Maldonado Moreno, a soybean breeder from INIFAP,

for research and academic purposes. Additionally, the Nainari,

Guayparime S-10, and Suaqui 86 soybean cultivars were obtained from

a commercial supplier in the state of Sonora, Mexico. The materials

JP30790 and JP28955 were generously provided for research and

academic purposes by Dr. Shoshi Kikuchi from the Genetic Resources

Center of the National Agriculture and Food Research Organization

at the National Institute of Agrobiological Sciences (NIAS) in Japan.

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

López et al. Rev. Fac. Agron. (LUZ). 2024 40(2): e2441113-7 |

The soybean germplasm bank at NIAS (https://www.gene.arc.go.jp/

databases_plant_search_en.php) conrms that JP30790 and JP28955

materials are free from the eect of lipoxygenase or the triple null

eect of Lox genes in mature grain. The Nainari variety is a mutant

variety developed by cobalt 60 from seeds of Suaqui 86 variety and

the Guayparime S-10 variety was developed from the Nainari variety

through crossing and selection (Rodríguez-Cota et al., 2017) (table 1).

Table 1. Soybean germplasm analyzed.

Number Germplasm Adaptation Progenitors

1 JP30790* USA Unknown

2 JP28955* USA Unknown

3 Vernal

Mexico D77-12244 X Bedford

4 Huasteca 100° Mexico Santa Rosa X Jupiter

5 Huasteca 200° Mexico F815344 X Santa Rosa

6 Huasteca 300° Mexico H82-1930 X H80-2535

7 Huasteca 400° Mexico DM301

8 Tamesi° Mexico Santa Rosa X H80-2535

9 Huasteca 600° Mexico H88-1880 X H88-3868

10 Huasteca 700° Mexico Santa Rosa X F81-5517

11 Nainari** Mexico Derived from Suaqui 86

12 Suaqui 86** Mexico

(Rad X Cajeme) X

(Tetabiate X Cajeme)

13 Guayparime S-10** Mexico Nainari X PI-171443

*= Soybean accessions deposited in the Japan NIAS gene bank; += North of the

Tamaulipas state; °= South of the Tamaulipas state (humid tropics); **= South of

the Sonora state (dry tropics).

Sequencing of mature grain Lox genes

To amplify the specic regions of the Lox1, Lox2, and

Lox3 genes, specic primers were designed using the DNAStar

LaserGene software. The reference sequences of these genes from

the cultivar Williams 82 V1.1 (GFC_000004515.3), deposited in

the NCBI database, were used for primer design (table 2). For PCR

amplication, 25 ng.µL of template DNA, isolated from young leaves

with Wizard® genomic kit protocol and the PCR Master Mix enzyme

from Promega were used. The thermocycling conditions for each

gene were as follows: an initial denaturation step at 94 °C for 2 min,

followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at

50 °C for 30 s, and elongation at 72 °C for 2.5 min. A nal elongation

step was performed at 72 °C for 5 min. The quality and specicity

of the PCR products were assessed by analyzing them on a 1.2 %

agarose gel electrophoresis, which allowed verication of the expected

amplicon sizes and conrmation of specic amplication (Kumar and

Rani, 2019).

Library construction and sequencing

For sequencing the amplied Lox gene fragments, the samples

were sent to the LANMDA-CBG-IPN National Laboratory. To prepare

the libraries for sequencing, the Nextera Flex Library Kit was used.

Individual indices were incorporated into the libraries for barcoding,

allowing for multiplexing of samples. The library preparation

process followed the Illumina reference guide #1000000025416 v07.

Finally, the prepared libraries were sequenced using the MiniSeq™

Sequencing System, which is an Illumina sequencing platform.

This system performs high-throughput sequencing of the libraries,

generating sequence data for each of the Lox genes in the samples.

Bioinformatic analysis of sequencing data

The sequence reads obtained from the MiniSeq™ Sequencing

System were aligned to the reference genome Williams 82 using the

Burrows-Wheeler Aligner (BWA-MEM) v0.7. This alignment process

helps to map the reads to their corresponding genomic positions. The

aligned reads were then processed using the Picard v1.135 program,

the processed reads were saved in BAM les. To identify variations

in the sequenced data, the Genomic Variant Call Format (GVCF)

workow was employed, specically using the HaplotypeCaller

program. The identied SNPs and single nucleotide variants (SNVs)

were saved in Variant Call Format (VCF) les and underwent ltering

based on specic criteria. These criteria include depth-normalized

variant condence (QD) <2.0, mapping quality (MQ) <40.0, strand

bias (FS) >60.0, HaplotypeScore >13.0, MQRankSum < -12.5, and

Read-PosRank-Sum < -8.0. Filtering helps to ensure the quality and

reliability of the detected variations. Finally, the Infogen software

(Balzarini and Di Rienzo, 2004) was used to determine allelic

frequencies.

Predictive analysis of the eect of SNPs on the protein

The potential eect of each SNP on the structure of the Lox1,

Lox2, and Lox3 genes was analyzed using the Sanger Institute’s

Table 2. Specic primers for the amplication of grain Lox genes of 13 soybean cultivars.

Number Direction Primers sequence Amplicon size* Position of amplicon

Lox1 gene

1 Forward 5’ TTCTTCTTCTTTATTTTCTCATTT 3’ 2,567bp 32-2598

Reverse 5’ GCCAAATTGTGCTCTCA 3’

2 Forward 5’ ACAATTATCCCCTTACCAGTG 3’ 2,495bp 1648-4142

Reverse 5’ TGATGACAGGAGCTAAACACAAAC 3’

Lox2 gene

1 Forward 5’ AGCTTTTCTTTTTCTTGTT 3’ 1,530bp 11-1540

Reverse 5’ AAAAATAAATCAGAATCATAGCAC 3’

2 Forward 5’ CTTTGGGAGCAGGGGAGTC 3’ 3,461bp 741-4201

Reverse 5’ AATAGTGCTCGGTGCTCTTA 3’

Lox3 gene

1 Forward 5’ TGATGCGCAAGAATGTG 3’ 4,346bp 105-4340

Reverse 5’ CACAAAGCAAAGCAGTA 3’

*= nucleotide base pairs

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2024, 41(2): e244111 April-June. ISSN 2477-9407.4-7 |

PFAM 34.0 database (http://pfam.xfam.org/) to identify traits of the

L-1, L-2 and L-3 proteins and obtain information about the function

of the protein. Subsequently, through predictions in the PROVEAN

program (http://provean.jcvi.org/seq_submit.php) the amino acid

changes produced by each SNP were analyzed and their potential

eect on protein stability was determined. The algorithm used

173 supporting sequences and the score thresholds for prediction

were as follows: variants with a score equal to or less than -2.5 are

considered “destabilizing” and variants with a score greater than -2.5

are considered “neutral”. This program pools BLAST results using

CD-HIT with a parameter of 75 % overall sequence identity. The 30-

best cluster of closely related sequences from the set of supporting

sequences that is used to generate the prediction, a delta alignment

score is calculated for each supporting sequence. Scores are averaged

within and across clusters to generate the nal PROVEAN score.

The last step consisted in analyzing the mutated sequence in the

Eukariotic Linear Motif (ELM) platform (http://elm.eu.org/search.

html) to identify putative motifs and nally modeling the protein

in the SWISS-MODEL program (https://swissmodel.expasy.org/

interactive) to determine its functionality.

Results and discussion

Size and traits of Lox genes

The sequences of exons and introns obtained from the Lox1,

Lox2, and Lox3 genes in Mexican soybean grains were compared

to the reference genome Williams 82. The coverage for Lox1, Lox2,

and Lox3 genes was 96 % (4,265 bp), 97.5 % (4,297 bp), and 100 %

(4,346 bp), respectively. Interestingly, the average sequence size of

exons and introns observed in the Mexican soybean population was

found to be greater than that reported by (Reinprecht et al., 2011; Lee

et al., 2014), who studied a mutant genotype and wild-type genotype.

The dierences in sequence size are particularly noticeable in the

Lox1 gene, as both studies reported a deletion of 74 bp in exon 8 of

the mutant genotype.

Lox1 gene

The Lox1 gene sequences in the Mexican soybean population

exhibited 26 SNPs compared to the reference sequence of the

Williams 82 cultivar (table 3). Other studies have reported a lower

number of SNPs associated with normal and null activity of the Lox1

when compared to the reference sequence of the Williams 82 cultivar

(Lenis et al., 2010; Reinprecht et al., 2011; Lee et al., 2014). Of the

26 SNPs found in the Lox1 gene of the Mexican soybean population,

14 were found in introns, while 12 were identied in exons. Out of the

12 SNPs identied in exons, eight were non-synonymous changes,

meaning they resulted in amino acid substitutions. Among these

eight SNPs, ve were transversions (C/A, A/T, G/C) and three were

transitions (A/G, G/A, G/A). The transversion SNPs were located in

exon 2 (C/A), resulting in a His-Asn amino acid change; in exon 4

(A/T), leading to a Glu-Asp amino acid change; and in exon 6 (G/C),

causing a Ser-Thr amino acid change. The most variable exon was

exon 9, which exhibited ve non-synonymous changes. It included two

transversions (G/C, C/A) resulting in Val-Leu and Leu-Ile amino acid

changes, as well as three transitions (A/G, G/A, G/A) leading to amino

acid changes of Ile-Val, Ala-Thr, and Gly-Asp, respectively (table 3).

Lox2 gene

In the Lox2 gene of the Mexican soybean population, a total of 17

SNPs were identied (table 3). Among these SNPs, 11 were located

in non-coding regions, while six were found in coding regions. Out

of the SNPs detected in exons, three SNPs were transversion with

non-synonymous changes. One transversion SNP (G/C) was found in

exon 6, resulting in a Glu-Asp amino acid change. Additionally, two

transversion SNPs (C/A) in exon 9 led to Pro-Thr and Pro-His amino

acid changes, respectively. The predictive analysis of non-synonymous

SNPs in the Mexican soybean population revealed that the G/C SNP

present in exon 6 destabilized the L-2 protein in the homozygous

C/C genotype in Guayparime S-10 and Huasteca 300 cultivars.

Other non-synonymous SNPs in the Lox2 gene have been reported in

previous studies. For example, Wang et al. (1994), Reinprecht et al.

(2011) and Lee et al. (2014) detected a non-synonymous exchange

of T/A in exon 8, resulting in an amino acid change from histidine

to glutamine. They observed that this mutation aected an iron

ligand essential for the activity of L-2, causing enzyme disfunction.

Additionally, Reinprecht et al. (2011) detected an A/A SNP at position

678, leading to the substitution of threonine with lysine in the Lox2

gene. The change to observed in the nsSNP G/C from exon 6 in

the Mexican soybean population led to the substitution of glutamic

acid (GAG) to aspartic acid (GAC) (tables 3, 4) and consequently,

an error occurred in the conformation of the LH2 globular domain

(Lipoxygenase homology 2) within the protein sequence due to the

low conservation of the DOC_PP4_FxxP_1 motifs (position 2-5)

and DOC_USP7_MATH_1 (position 5-9). These modications

altered the conserved ligand-binding site of the protein in the mutated

protein sequence compared to the corresponding protein sequence

of the Williams 82 reference material (accession SM00308, position

17-176). By examining the direct ancestors of the Guayparime S-10

cultivar, it was observed that both the Nainari mutant and the normal

Suaqui 86 cultivars did not contribute the C allelic variant to the

Guayparime S-10 (tables 3 and 4). This is evident from their normal

G/G genotype. Instead, the C allelic variant in the Guayparime S-10

variety originated from the PI-171443 line, which served as a direct

parent in the genetic cross with the Nainari mutant variety during

the development of Guayparime S-10. The PI-171443 line carries the

Rym1 and Rym2 genes, which confer tolerance to Mung Bean Yellow

Mosaic Begomovirus (Rodríguez-Cota et al., 2017; Rani and Kumar,

2020). The allelic contribution of the PI-171443 line to the soybean

population in the Mexican dry tropics, is likely associated with an

improvement in the reduced activity of the L-2 enzyme in mature

grains where Guayparime S-10 exhibited a desirable attribute of low

beany or rancid avor (López-Fernández et al., 2022).

The Huasteca 300 cultivar in the Mexican soybean population

shares genetic information with the Huasteca 100, Tamesi, and

Huasteca 600 cultivars, which were developed using the Iowa and

Jupiter cultivars parents in single (Huasteca 100) and double genetic

crosses (Huasteca 300, Tamesi, and Huasteca 600). However, the

Huasteca 300 cultivar also possesses unique genetic information

contributed by the parent F76-9835, which is not found in any other

Mexican soybean cultivar (table 1). Upon genotyping the nsSNP G/C,

it was observed that the Huasteca 100, Tamesi, and Huasteca 600

cultivars do not exhibit the allelic change from G to C (tables 3 and 4).

Therefore, the C allelic variant causing destabilization of the L-2 protein

in the Huasteca 300 cultivar is likely attributed to the parent F76-9835.

The F76-9835 line was introduced to Mexico for use as a parent in

genetic improvement, primarily aimed at enhancing the long juvenile

trait in Mexican soybean populations. This trait contributes to a delayed

owering time and improved plant size under short photoperiods.

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

López et al. Rev. Fac. Agron. (LUZ). 2024 40(2): e2441115-7 |

Table 3. Location and frequency of SNPs.

Number

Reference

location

Gene location SNPs

Allele frequency

Amino acid

change

A G C T

Lox1 gene

1 42329191 Exon 1 T/A 0.2000 0.8000 Arg-Arg

2 42329248 Intron 1 A/T 0.5000 0.5000

3 42329367 Intron 1 G/T 0.8000 0.2000

4 42329383 Intron 1 C/T 0.8000 0.2000

5 42329522 Intron 1 T/A 0.2000 0.8000

6 42329549 Exon 2 C/A 0.2000 0.8000 His-Asn

7 42330262 Intron 3 C/G 0.2917 0.7083

8 42330372 Intron 3 T/G 0.2917 0.7083

9 42330423 Exon 4 A/T 0.7083 0.2917 Glu-Asp

10 42330876 Intron 4 C/T 0.4615 0.5385

11 42330884 Intron 4 T/C 0.2692 0.7308

12 42330888 Intron 4 T/G 0.2692 0.7308

13 42331050 Intron 5 A/C 0.5000 0.5000

14 42331083 Intron 5 G/T 0.4583 0.5417

15 42331134 Intron 5 A/T 0.7083 0.2917

16 42331199 Exon 6 G/C 0.7083 0.2917 Ser-Thr

17 42331273 Intron 6 A/C 0.4167 0.5833

18 42331544 Exon 7 C/T 0.7083 0.2917 Val-Val

19 42332038 Intron 8 C/A 0.2917 0.7083

20 42332188 Exon 9 G/C 0.7083 0.2917 Val-Leu

21 42332220 Exon 9 C/T 0.7083 0.2917 Ala-Ala

22 42332242 Exon 9 G/A 0.2917 0.7083 Ala-Thr

23 42332262 Exon 9 T/C 0.2692 0.7308 Val-Val

24 42332424 Exon 9 C/A 0.2692 0.7308 Leu-Ile

25 42332433 Exon 9 A/G 0.7308 0.2692 Ile-Val

26 42332806 Exon 9 G/A 0.0385 0.9615 Gly-Asp

Lox

2 gene

1 42322045 Intron 1 T/C 0.3571 0.6071

2 42322161 Intron 1 G/A 0.3846 0.6154

3 42323112 Intron 3 G/A 0.3846 0.6154

4 42323153 Intron 3 T/C 0.3846 0.6154

5 42323180 Intron 3 T/G 0.3846 0.6154

6 42323648 Intron 4 C/T 0.6364 0.3636

7 42323835 Intron 5 G/A 0.5000 0.5000

8 42323904 Intron 5 A/G 0.8077 0.1923

9 42324015 Exon 6 G/C 0.8462 0.1538 Glu-Asp

10 42324197 Intron 6 C/A 0.1667 0.8333

11 42324352 Exon 7 C/T 0.9583 0.0417 Thr-Thr

12 42324587 Intron 7 T/A 0.1667 0.8333

13 42324588 Intron 7 A/T 0.8333 0.1667

14 42325120 Exon 9 C/A 0.0385 0.9615 Pro-Thr

15 42325121 Exon 9 C/A 0.0385 0.9615 Pro-His

16 42325167 Exon 9 T/C 0.0385 0.9615 Gly-Gly

17 42325177 Exon 9 C/T 0.9615 0.0385 Leu-Leu

Lox3 gene

1 2125400 Intron 2 A/G 0.3846 0.6154

2 2126115 Exon 5 T/G 0.6154 0.3846 Asp-Glu

3 2126489 Exon 6 G/A 0.6154 0.3846 Arg-Arg

4 2126715 Intron 6 T/G 0.6154 0.3846

5 2127691 Exon 8 A/G 0.3846 0.6154 Ala-Ala

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2024, 41(2): e244111 April-June. ISSN 2477-9407.6-7 |

Table 4. Predictive analysis of the eect of nsSNPs on the protein

in the mexican soybean population.

*Position **nsSNP Exon

Amino

acid

variant

Eect

Destabilized

genotype

Lox1 gene

42329549 C/A 2 H53N Neutral

42331199 G/C 6 S379T Neutral

42332188 G/C 9 V600L Neutral

42332242 G/A 9 A618T Neutral

42332424 C/A 9 L679I Neutral

42332433 A/G 9 I682V Neutral

42332806 G/A 9 G806D Neutral

Lox2 gene

42324015 G/C 6 E393D Destabilizing

C/C

(Guayparime

S-10 and

Huasteca 300)

42325120 C/A 9 P669T Neutral

42325121 C/A 9 P669H Neutral

Lox2 gene

2126115 T/G 9 D382E Neutral

*= Location of the SNP conforms to the reference sequence of the Williams 82

cultivar; **= non synonymous SNPs

In studies by Reinprecht et al. (2011) and Lee et al. (2014), only

three non-synonymous substitutions in exons 2 and 3 were detected,

resulting in amino acid changes. The predictive analysis of the eight

non-synonymous SNPs detected in the Lox1 gene of the Mexican

soybean population showed no destabilization of the L-1 protein. The

PROVEAN analysis supported these ndings by indicating a neutral

eect of the nsSNPs on the L-1 protein (table 4). This neutral eect

was observed not only in the mutant cultivars Nainari and Guayparime

S-10 but also in the JP28955 and JP30790 cultivars, as well as in

the overall Mexican soybean population. These results contrast with

previous reports by Lenis et al. (2010) and Lee et al. (2014), who

identied a 74 bp deletion in exon 8 that inuenced the transcription

of the L-1 protein in mutant lines. The limited genetic variation

observed in the Lox1 gene of the Mexican soybean population can be

attributed to the genome homogenization resulting from the selection

and xation of specic alleles associated with soybean breeding

programs in Mexico (Ascencio and Maldonado, 1998; Rodríguez-

Cota et al., 2017).

Lox3 gene

The Lox3 gene in the Mexican soybean population exhibits

lower genetic variation compared to the Lox1 and Lox2 genes, as

observed in the reference sequence of the Williams 82 material. The

limited genetic variability of the Lox3 gene in the Mexican soybean

population is consistent with previous reports at both the intron and

exon levels (Reinprecht et al., 2011; Lee et al., 2014), suggesting

that the Lox3 gene is less variable than Lox1 and Lox2. In the Lox3

gene of the Mexican soybean population, a total of ve SNPs were

identied (table 3). Two SNPs were located in introns, while three

transversion SNPs were found in exons 5, 6, and 8. Among these

SNPs, the nsSNP T/G in exon 5 resulted in an amino acid change

from aspartic acid to glutamic acid. However, the predictive analysis

of the three non-synonymous SNPs detected in the Lox3 gene of the

Mexican soybean population showed no destabilization of the L-3

protein. Similar changes and polymorphisms have been reported in

the Lox3 gene, both with and without eects on the L-3 protein. For

example, Lenis et al. (2010) detected a nucleotide change in exon 1

compared to the reference sequence of the Williams 82 cultivar. This

nucleotide change altered the reading frame of the Lox3 gene, leading

to the truncation of the functional L-3 protein in mutant soybean

genotypes. Reinprecht et al. (2011) identied three SNPs in exons 6,

7, and 9 between a mutant and wild-type sequence, but these SNPs

did not have an eect on the functioning of the L-3 protein. Lee et al.

(2014) also reported changes in the Lox3 gene. They identied two

non-synonymous G/A nucleotide changes in exons 6 and 9, resulting

in histidine to arginine and isoleucine to valine amino acid changes,

respectively, in a wild-type and mutant genotype.

In silico analysis of SNPs eect on the protein

The predictive analysis of this nsSNP G/C detected in exon 6

revealed the presence of 79 and 65 putative motifs before and after

data ltering, respectively, which is one more than the reference

sequence of cultivar Williams 82. However, it is worth noting that the

L-2 protein aected by the nsSNP G/C at position 42324015 (E393D)

did not exhibit changes in structural conformation compared to the

normal protein as shown in gure 1.

Figure 1. Model of normal L-2 protein (a) and model of the L-2

protein aected by SNP G/C at position 42324015 (b).

Conclusions

In conclusion, our study reveals signicant genetic diversity

within the introns and exons of Lox genes in the Mexican soybean

population, with Lox3 exhibiting less variability compared to Lox1

and Lox2. Notably, nsSNPs found in the Mexican population have

a neutral impact on L-1 and L-3 proteins. Moreover, our analysis

suggests no destabilizing eects on lipoxygenase proteins in

lipoxygenase-free JPs materials, prompting further exploration of

alternative genetic regions and biochemical analyses, including

enzymatic activity assessments and volatile compound quantication.

The G/C E392D nsSNP in exon 6, showcasing destabilizing eects

on L-2 protein in specic cultivars, holds potential as a valuable

polymorphism for enhancing grain quality in Mexican soybean

populations through breeding strategies.

Acknowledgments

Mónica López-Fernández thanks the IPN (BEIFI scholarship) and

CONAHCYT (CONAHCYT scholarship) for providing the student

scholarships that allowed me to carry out doctoral studies and publish

this manuscript.

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

López et al. Rev. Fac. Agron. (LUZ). 2024 40(2): e2441117-7 |

Literature cited

Ascencio, L. G., & Maldonado, M. N. (1998). Crecimiento y desarrollo de la soya

en el sur de Tamaulipas, México. Agricultura Técnica en México, 24(2),

99-110. https://www.acuedi.org/ddata/1274.pdf.

Balzarini, M., & Di Rienzo, J. (2004). Info-Gen: Software para análisis estadístico

de datos genéticos. Universidad Nacional de Córdoba. Córdoba.

Argentina. https://www.info-gen.com.ar/.

Carpentieri-Pipolo, V., Barreto, T. P., da Silva, D. A., Abdelnoor, R. V., Marin,

S. R., & Degrassi, G. (2021). Soybean Improvement for Lipoxygenase-

free by Simple Sequence Repeat (SSR) Markers Selection. Journal of

Botanical Research, 3(1), 23-31. https://doi.org/10.30564/jrb.v3i1.2818.

Davies, C. S., Nielsen, S. S., & Nielsen, N. C. (1987). Flavor improvement of

soybean preparations by genetic removal of lipoxygenase-2. Journal

of the American Oil Chemists’ Society, 64(10), 1428-1433. https://doi.

org/10.1007/BF02636994.

Hinson, K., & Hartwig, E. E. (1977). Soybean production in the tropics. FAO. 4,

p222. https://www.cabdirect.org/cabdirect/abstract/19786724286.

Kumar, V., & Rani, A. (2019). Development of lipoxygenase-3 free Indian

soybean using gene-mutation based molecular markers. Indian Journal

of Experimental Biology, 57, 540-544. https://nopr.niscpr.res.in/

handle/123456789/48474.

Lee, K. J., H. Wang, J. E., Velusamy, V., Ha, B. K., Kim, J. B., Kim, S. H., & Kim,

D. S. (2014). Selection and molecular characterization of a lipoxygenase-

free soybean mutant line induced by gamma irradiation. Theoretical and

applied genetics, 127, 2405-2413. https://doi.org/10.1007/s00122-014-

2385-9.

Lenis, J. M., Gillman, J. D., Lee, J. D., Shannon, J. G., & Bilyeu, K. D. (2010).

Soybean seed lipoxygenase genes: molecular characterization and

development of molecular marker assays. Theoretical and Applied

Genetics, 120, 1139-1149. https://doi.org/10.1007/s00122-009-1241-9.

López-Fernández M., Castillo-Ruíz O., & Gill-Langarica H. R. (2022). First

sensory analysis of soybean drinks made from commercial grain grown

in Mexico. Czech Journal of Food Sciences, 40(5), 400-406. https://doi.

org/10.17221/153/2021-CJFS.

Maldonado-Moreno, N., & Ascencio-Luciano, G. (2012). Tamesí, nueva variedad

de soya para el trópico húmedo de México. Revista mexicana de

ciencias agrícolas, 3(8), 1671-1677). https://www.scielo.org.mx/scielo.

php?pid=S2007-09342012000800017&script=sci_arttext.

Rani, A., & Kumar, V. (2020). Translational genomics and breeding in soybean.

Accelerated Plant Breeding, Volume 3: Food Legumes, pp. 343-367.

https://doi.org/10.1007/978-3-030-47306-8_11.

Reinprecht, Y., Luk-Labey, S. Y., Yu, K., Poysa, V. W., Rajcan, I., Ablett, G. R., &

Peter Pauls, K. (2011). Molecular basis of seed lipoxygenase null traits in

soybean line OX948. Theoretical and applied genetics, 122, 1247-1264.

https://doi.org/10.1007/s00122-011-1528-5.

Rodríguez-Cota, F. G., Manjarrez-Sandoval, P., Cortez-Mondaca, E., Sauceda-

Acosta, R. H., Valenzuela-Herrera, V., González-González, D., & Velarde-

Félix, S. (2017). Guayparime S-10, nueva variedad de soya resistente a

mosca blanca y geminivirus para Sinaloa. Revista mexicana de ciencias

agrícolas, 8(1), 241-245. https://doi.org/10.29312/remexca.v8i1.88.

Shin, J. H., Van, K., Kim, K. D., Lee, Y. H., Jun, T. H., & Lee, S. H. (2012).

Molecular sequence variations of the lipoxygenase-2 gene in soybean.

Theoretical and Applied Genetics, 124, 613-622. https://doi.org/10.1007/

s00122-011-1733-2.

Singh, G., Dukariya, G., & Kumar, A. (2020). Distribution, importance and

diseases of soybean and common bean: A review. Biotechnology Journal

International, 24(6), 86-98. https://doi.org/10.9734/bji/2020/v24i630125.

Suda, I., Hajika, M., Nishiba, Y., Furuta, S., & Igita, K. (1995). Simple and rapid

method for the selective detection of individual lipoxygenase isoenzymes

in soybean seeds. Journal of Agricultural and Food Chemistry, 43(3),

742-747. https://doi.org/10.1021/jf00051a034.

Wang, W. H., Takano, T., Shibata, D., Kitamura, K., & Takeda, G. (1994).

Molecular basis of a null mutation in soybean lipoxygenase 2: substitution

of glutamine for an iron-ligand histidine. Proceedings of the National

Academy of Sciences, 91(13), 5828-5832. https://doi.org/10.1073/

pnas.91.13.5828.