University of Zulia, Faculty of Agronomy

Bolivarian Republic of Venezuela

Keywords:

GLX-I

Stress

Proteins

Aspergillus

Glyoxalase I (GLX-I) analysis in native maize from Oaxaca, Mexico, infected with Aspergillus

avus in vitro

Análisis de glioxalasa I (GLX-I) en maíces nativos de Oaxaca, México, infectados con Aspergillus

avus in vitro

Análise de Glyoxalase I (GLX-I) em milho nativo de Oaxaca, México, infectado com Aspergillus

avus in vitro

Tecnológico Nacional de México/Instituto Tecnológico de

Oaxaca. Avenida Ing. Víctor Bravo Ahuja No. 125, Esquina

Calzada Tecnológico; 68030. Oaxaca, México.

Centro de Investigación Facultad de Medicina UNAM-

UABJO. Ex Hacienda de Aguilera S/N, Calz. San Felipe del

Agua, Oaxaca, México.

Laboratorio de Bioquímica y Biología Molecular, Centro de

Química del Instituto de Ciencias (ICUAP), Edicio 103F,

Ciudad Universitaria, Benemérita Universidad Autónoma de

Puebla, Puebla, México.

Received: 29-03-2022

Accepted: 04-09-2022

Published: 21-09-2022

Abstract

The glyoxalase system plays an important role in various physiological

processes in plants when they are subjected to different types of stress, whether

physical, chemical or biological. Aspergillus avus is an aatoxin-producing

fungus that contaminates dry grains, leading to a gradual deterioration of the

grains and a signicant reduction in their nutritional value. The objective

of the present study was to evaluate the activity of the enzyme glyoxalase I

(GLX-I) in maize coleoptiles from Oaxaca in response to infection caused

by Aspergillus avus. Nine maize samples from four different races were

analyzed. The samples were inoculated with a suspension of Aspergillus

avus spores of known concentration and total protein extraction and

quantication were performed on the coleoptiles, and GLX-I activity was

determined by quantifying the amount of S-lactoylglutathione produced per

minute. In addition, analysis of gene expression by reverse transcriptase

polymerase chain reaction (RT-PCR) was performed. The inoculated maize

coleoptiles showed symptoms of infection, color changes and wilting. The

concentration of total proteins decreased signicantly in the extracts of four

samples in the presence of the fungus. In the GLX-I analysis, two samples

had the highest enzymatic activity in the infected coleoptile extract with

respect to the healthy one, in addition to presenting greater expression of

the gene in the RT-PCR assay, this due to the response to Aspergillus avus

infection.

Carlos Francisco Varapizuela-Sánchez

Marco Antonio Sánchez-Medina

María del Socorro Pina-Canseco

Nora Hilda Rosas-Murrieta

Alma Dolores Pérez-Santiago

Iván Antonio García-Montalvo

Rev. Fac. Agron. (LUZ). 2022, 39(4): e223946

ISSN 2477-9407

DOI: https://doi.org/10.47280/RevFacAgron(LUZ).v39.n4.0

Crop Production

Associate editor: Professor Andreina Garcia de Gonzalez

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2022, 39(4): e223946. October-December. ISSN 2477-9407.

2-6 |

Resumen

El sistema glioxalasa juega un papel importante en diversos

procesos siológicos en plantas cuando son sometidas a diferentes

tipos de estrés, ya sean físicos, químicos o biológicos. Aspergillus

avus es un hongo productor de aatoxinas que contamina granos

secos, lo que conlleva a un deterioro paulatino de los granos y la

reducción signicativa de su valor nutrimental. El objetivo del

presente estudio fue evaluar la actividad de la enzima glioxalasa I

(GLX-I) en coleoptilos de maíces de Oaxaca como respuesta a la

infección producida por Aspergillus avus. Se analizaron nueve

muestras de maíz de cuatro razas diferentes. Las muestras se

inocularon con una suspensión de esporas de Aspergillus avus de

concentración conocida y a los coleoptilos se les realizó la extracción

y cuanticación de proteínas totales y se les determinó la actividad

de GLX-I cuanticando la cantidad de S-lactoilglutatión producida

por minuto. Además, se realizó el análisis de la expresión del gen

por reacción en cadena de la polimerasa transcriptasa reversa (RT-

PCR). Los coleoptilos de maíz inoculados presentaron síntomas de

infección, cambios de coloración y marchitamiento. La concentración

de proteínas totales disminuyó signicativamente en los extractos de

cuatro muestras ante la presencia del hongo. En el análisis de GLX-I,

dos muestras tuvieron la mayor actividad enzimática en el extracto

de coleoptilo infectado con respecto al sano, además de presentar

mayor expresión del gen en el ensayo de RT-PCR, esto debido como

respuesta a la infección por Aspergillus avus.

Palabras clave: GLX-I, estrés, proteínas, Aspergillus.

Resumo

O sistema glioxalase desempenha um papel importante em vários

processos siológicos em plantas quando estas são submetidas

a diferentes tipos de estresse, seja físico, químico ou biológico.

Aspergillus avus é um fungo produtor de aatoxinas que contamina

grãos secos, levando a uma deterioração gradual dos grãos e uma

redução signicativa em seu valor nutricional. O objetivo do presente

estudo foi avaliar a atividade da enzima glioxalase I (GLX-I) em

coleóptilos de milho de Oaxaca em resposta à infecção causada por

Aspergillus avus. Nove amostras de milho de quatro raças diferentes

foram analisadas. As amostras foram inoculadas com uma suspensão

de esporos de Aspergillus avus de concentração conhecida e a extração

e quanticação da proteína total foram realizadas nos coleóptilos, e a

atividade do GLX-I foi determinada pela quanticação da quantidade

de S-lactoilglutationa produzida por minuto. Além disso, foi realizada

a análise da expressão gênica por reação em cadeia da polimerase com

transcriptase reversa (RT-PCR). Os coleóptilos de milho inoculados

apresentaram sintomas de infecção, alterações de cor e murchamento.

A concentração de proteínas totais diminuiu signicativamente nos

extratos de quatro amostras na presença do fungo. Na análise de

GLX-I, duas amostras apresentaram a maior atividade enzimática

no extrato de coleóptilo infectado em relação ao saudável, além de

apresentarem maior expressão do gene no ensaio de RT-PCR, isso

devido à resposta à infecção por Aspergillus avus.

Palavras-chave: GLX-I, estresse, proteínas, Aspergillus.

Introduction

Maize is the main agricultural product in Mexico (Rosado and

Villasante, 2021), 18,151,034 million hectares are planted annually,

with an average harvested area of 17,229,616 ha (Agrifood and

Fisheries Information Service [SIAP], 2021), and its diversity is found

in traditional agricultural systems. The crops plant native varieties

and through their knowledge, the preferences and practices they have

developed, they will be able to maintain the diversity in this crop

(Fernández et al., 2013; Cabrera et al., 2015). The so-called “creole

or native breeds” are the result of the traditional manipulation of the

peasants and the environmental variability present in the numerous

ecological niches in which they are cultivated, which contribute to

the conservation and generation of the genetic diversity of the crop,

coming to form new types, varieties or races (Arteaga et al., 2016;

Orozco-Ramírez et al., 2016). Of the 59 breeds identied in the

country (Fernández et al., 2013), 35 are reported in Oaxaca, which

represents 59 % of the total existing diversity in Mexico (Aragón-

Cuevas et al., 2006; Kato, 2009). Maize production in Mexico is

characterized by being cultivated in the rainy season, which during its

growth and storage is exposed to contamination by fungi, including

Aspergillus avus, generating economic losses of production and

production problems public health due to the consumption of food

contaminated by aatoxins (Martínez et al., 2013).

On the other hand, stress is an unavoidable limiting factor for

agriculture and is becoming a major problem in the modern world,

reducing up to 50 % of crop yields globally (Bandyopadhyay et al.,

2016). Plants grown under natural conditions are constantly subjected

to a wide variety of abiotic stresses such as salinity, drought and

toxic metals, which cause the production of cytotoxic compounds

such as methylglyoxal (MG) and the response of macromolecules

to eliminate it (Hasanuzzaman et al., 2017a; Ben et al., 2018).

Methylglyoxal is a natural metabolite and a highly reactive cytotoxic

compound, produced when organisms are subjected to some type

of stress, mainly abiotic (Ghosh, 2017; Borysiuk et al., 2018); it

can damage and modify proteins, lipids, carbohydrates and DNA,

resulting in cell death, therefore it is important for cells to detoxify

to survive (Rohman et al., 2016). MG is removed by the glyoxalase

system mainly by two enzymes, GLX-I and GLX-II. GLX-I catalyzes

the transformation of MG into S-D-lactoylglutathione through the use

of a reduced glutathione (GSH) molecule, while GLX-II catalyzes

the formation of D-lactate from S-D-lactoylglutathione, allowing the

regeneration of the molecule reduced glutathione (Turra et al., 2015);

In this way, the glyoxalase system could play an important role in

plant tolerance to stress by recycling GSH and, therefore, maintaining

the homeostasis of this molecule (Ghosh et al., 2016; Hasanuzzaman

et al., 2017b).

To improve the response of plants to unfavorable growth conditions,

it is necessary to know their response mechanisms to stress. In hybrid

maize, the response of GLX-I was analyzed in samples that showed

resistance to aatoxin production by A. avus (Chen et al., 2004),

however, the activity of this enzyme in native maize from Oaxaca

raised with A. avus has not been studied. Therefore, this research

aimed to analyze the response of GLX-I to infection by A. avus in

coleoptiles of native maize from the state of Oaxaca.

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Varapizuela-Sánchez et al. Rev. Fac. Agron. (LUZ). 2022, 39(4): e2239463-6 |

Materials and methods

Samples of native maize from Oaxaca

Nine samples of 4 races from different collection points of native

maize from Oaxaca donated by Flavio Aragón Cuevas, researcher

at the Instituto Nacional de Investigaciones Forestales Agrícolas y

Pecuarias en Oaxaca (INIFAP) were analyzed. Table 1 describes the

samples.

Table 1. Samples of native maize from the state of Oaxaca

evaluated.

Sample Race Color Place of origin

1 Bolita Belatove Central valleys

2 Bolita Yellow Central valleys

3 Bolita Yellow Central valleys

4 Bolita Blue Central valleys

5 Conejo veloz White Costa

6 Bolita White Central valleys

7 Costeño White Costa

8 Zapalote Purple Costa

9 Bolita Blue Central valleys

Aspergillus avus strain

For the infection tests, an A. avus strain isolated from dried

chili peppers marketed in Oaxaca and characterized in the Food

Laboratory of the Tecnológico Nacional de México, Oaxaca campus

for its aatoxin production was used. An aliquot of 0.1 mL of a

concentrated solution of spores was inoculated on plates with potato-

dextrose agar (PDA) medium and incubated for 7 days at 28 ± 2 °C

in a Labolan brand incubator. The spores were recovered in water

containing 0.01% triton and stored at 5 °C until used.

Obtaining maize coleoptiles

To obtain maize coleoptiles, the procedure reported by Varapizuela

et al. (2019) was used. Thirty seeds of each sample were disinfected

by immersion in a 70 % ethyl alcohol solution for 10 minutes and

rinsed three times with sterile distilled water. Five grains of each

sample were placed in a Petri dish with a cotton bed and moistened

lter paper, being this an experimental unit. Three plates were used

as healthy controls inoculated with 50 µL of sterile water and three

more were inoculated with 50 µL of an A. avus spore suspension of

4×10

spores.mL

-1

to each grain. The plates were incubated at 28 ± 2

°C for 7 days.

Extraction and quantication of total proteins

Protein extraction was performed by maceration with a 1:2 (w/v)

ratio using the extraction buffer reported by Chen et al. (2007) with

some modications, which contained 0.25 M NaCl, 50 mM Tris-HCl

pH 8.0 and 14 mM β-mercaptoethanol and centrifuging the samples at

12,000 rpm for 15 minutes. The supernatants obtained were quantied

in triplicate by the Bradford technique using a BSA (bovine serum

albumin) standard curve and stored at -20 °C in a Frigidaire® freezer

until used.

GLX-I enzyme activity assay

The glyoxalase I (GLX-I) enzymatic activity of maize coleoptile

extracts from healthy and A. avus-infected samples was determined

according to the assay reported by Chen et al. (2004). The assay

mixture contained 100 mM sodium phosphate buffer pH 7.5, 3.5 mM

methylglyoxal (MG), 1.7 mM reduced glutathione (GSH), and 16.0

mM magnesium sulfate in a nal volume of 1 mL. The mixture was

transferred to a quartz cell and incubated at ± 27 °C for 1 minute. The

reaction began by adding the enzymes of the extracts obtained by

maceration (0.02 mL of crude extract or extract boiled for 10 minutes

at 100 ºC as control) and the formation of S-D-lactoylglutathione

thioester was monitored by measuring the increase in absorbance at

240 nm in a SmartSpecTM 3000 spectrophotometer (BIO-RAD) at

20 minutes. The absorbance was converted to a molar amount using

the molecular coefcient of 3.370 µmol for S-lactoylglutathione. One

unit of absorbance is dened as 1 µM S-lactoylglutathione.min

-1.

The

assay was performed in triplicate for each extract.

Analysis of data

Total protein quantication data were analyzed based on the

mean and standard deviations (means and standard deviation of

three replicates and three values per replicate). Data analysis of

GLX-I activity was determined by analysis of variance and Tukey’s

statistical test using Minitab17 software. The samples that presented a

statistically signicant difference in the enzymatic activity assay were

analyzed by Reverse Transcriptase PCR.

Analysis of GLX-I gene expression by Reverse Transcriptase

PCR

For the extraction of RNA from maize coleoptiles, the Guanidine

Thioisocyanate method (Chomczynski and Sacchi, 1987) was

used and the samples were stored at -20 °C until use. The GLX-I

oligos designed by José Luis Hernández Morales belonging to the

Tecnológico Nacional de México/Instituto Tecnológico de Oaxaca

were used based on the sequences reported in genbank with No.

NCBI AY241545, Forward (5´ GGTAGTGAAGCCTCGAAGG 3´)

and Reverse (3´ GCATTACTACATCCTAGCACAGC 5´), using as

positive control the oligos of the Mac1 maize actin gene (Baker et

al., 2009), Forward (5’ GTGACAATGGCACTGGAATG 3’) and

Reverse (5’ GACCTGACCATCAGGCATCT 3’), No. NCBI J01238,

both with a molecular weight of 900 bp. For the reaction, the Quiagen

kit for RT (Reverse Transcriptase) was used following the supplier’s

instructions and a concentration of 250 ng of maize coleoptile RNA.

The reaction was carried out in a BIO-RAD MyCycler thermal

cycler with a reverse transcriptase at 50 °C, 30 minutes, initial PCR

activation at 95 °C, 15 minutes and 35 cycles of: denaturation at 94

°C, 30 seconds, alignment 52 °C, 30 seconds, extension 72 °C, 45

seconds, ending with a nal extension cycle at 72 °C for 10 minutes.

The PCR products were analyzed on 2% agarose gels. Densitometry

analysis of GLX-I expression in the agarose gel was performed using

ImageJ software version 1.8.0 (https://imagej.net/software/imagej/),

which calculates the area and statistics of the pixels of dened sections

(Schneider et al., 2012). The extraction was performed in triplicate.

Results and discussion

Obtaining maize coleoptiles

Physiological differences were found between the growth of

healthy maize coleoptiles and those infected with A. avus. Healthy

coleoptiles showed greater elongation, light yellow color with hyaline

parts, as well as greater thickness (gure 1a).

All samples of infected coleoptiles presented smaller size, brown

to black pigmentation and wilting (gure 1b), symptoms like those

reported by Varapizuela et al. (2019), where the infection produced

by Aspergillus parasiticus in coleoptiles of native Oaxacan maize

presented wilting and chlorosis. This may be since the fungus uses

the coleoptiles as a substrate for its development.

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Rev. Fac. Agron. (LUZ). 2022, 39(4): e223946. October-December. ISSN 2477-9407.

4-6 |

a stress generated by an excess or a decit of nitrogen in the plant,

unlike that reported by Borysiuk et al. (2018), where the excess of

nitrogen in Arabidopsis plants excessively increased the levels of

methylglyoxal, inhibiting the capacity of the detoxifying pathway

of the glyoxalase system and generating severe damage to proteins.

Resistance to stress generated by biotic or abiotic factors in plants

is a mechanism that encompasses many enzymes that counteract the

damage generated by the stress produced, which depend on the type

of plant and growth conditions to present activity (Hasanuzzaman

et al., 2017a; Hasanuzzaman et al., 2017b; Kaur et al., 2017).

Table 2. Enzymatic activity of glyoxalase I (GLX-I) in maize

coleoptiles.

Sample

µmol S-lactoilglutation.mg

-1

of protein.min

-1

Healthy coleoptile Infected coleoptile

1 0.507

0.772

2 0.267

0.668

3 0.498

0.649

4 0.302

0.454

5 0.415

0.609

6 0.473

0.637

7 0.436

0.386

8 0.684

0.653

9 0.559

0.551

*Values followed by the same letter do not differ signicantly according to

Tukey’s statistical test (p≤ 0.05).

Analysis of GLX-I expression by RT-PCR

Samples 1 and 5 showed more than double the expression of

the gene in infected coleoptiles compared to samples from healthy

coleoptiles. On the other hand, sample 9 of infected coleoptiles

showed lower expression of the gene compared to the healthy

coleoptile, however, the difference was not signicant (gure 3).

Figure 3. RT-PCR products of the GLX-I gene from healthy

maize coleoptiles and those infected with Aspergillus

avus in 2 % agarose gel. Lane 1, amplied actin gene

(900 bp) in healthy sample 1. Lanes 2 to 4, shows 1

healthy. Lanes 5 to 7, sample 1 infected. Lanes 8 to 10,

shows 5 heals. Lanes 11 to 13, sample 5 infected. Lanes

14, to 16, shows 9 healthy. Lanes 17 to 19, sample 9

infected.

Alvarez-Gerding et al. (2015), analyzed the overexpression

of glyoxalase I and glyoxalase II genes in transgenic samples of

reed Phragmites australis compared to wild type when stressed by

salinity. The transgenic samples increased the expression of the

glyoxalase I and II genes, also reducing the physiological damage

caused in the plant compared to the wild type. According to what

was reported by Fountain et al. (2010), in maize samples, the

expression of the GLX-I gene did not show signicant changes in

expression, since the physiological stress induced by drought was

Healty

Contaminated

Figure 1

. Growth of coleoptiles of maize native to Oaxaca from

sample 1 of the bolita race. a) Healthy coleoptile. b)

Coleoptile infected with Aspergillus avus.

Total protein quantication

Samples 2, 3, 5 and 9 showed a signicant decrease in the

concentration of total proteins in relation to healthy coleoptiles

(gure 2). Sadiq et al. (2011), reported a decrease in protein for rice

coleoptiles when the seeds are germinated under anoxic conditions,

however, there was an increase in specic stress response proteins.

The overproduction of reactive oxygen species and cytotoxic

compounds can lead to the malfunction of the synthesis of structural

proteins for plant development, but they can trigger the response

of specic enzymes to counteract the damage caused (Bania and

Mahanta, 2012; Li, 2016).

Figure 2. Quantication of total proteins of the extracts of

healthy maize coleoptiles and those infected with

Aspergillus avus.

GLX-I enzyme activity

In Tukey’s analysis of GLX-I activity (table 2), it was found

that samples 1 and 5 had a statistically signicant higher enzymatic

activity in infected coleoptiles compared to healthy ones, while

sample 9 had higher enzymatic activity in the healthy coleoptile

than in the infected one. This result could indicate that the activity

of the enzyme is not always related to the changes or stress suffered

by the plant. Chen et al. (2004), evaluated the enzymatic activity

of GLX-I in 6 samples of healthy hybrid maize inoculated with A.

avus, reporting that only in one there was a signicant difference

in the enzymatic activity in maize inoculated with the fungus

compared to the control without inoculate, whose data related to

the response of this enzyme with resistance to aatoxin production,

these results coincide with those reported in this investigation.

On the other hand, Ben et al. (2018) reported an increase in the

activity of the glyoxalase system in sorghum plants, when there is

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Varapizuela-Sánchez et al. Rev. Fac. Agron. (LUZ). 2022, 39(4): e2239465-6 |

not enough to stimulate signicant changes. The maize coleoptiles

analyzed in this work that presented higher enzymatic activity and

greater gene expression were more resistant to infection, unlike those

that presented low enzymatic activity and gene expression, since

these changes can be affected by factors such as the environmental

ones, this is because some samples of the same race present different

susceptibility.

The resistance of plants to the stress generated by biotic or

abiotic conditions is a very important issue, since knowing better

the resistance mechanisms will help to improve the treatments to

which they are subjected to increase their quality and production.

Several detoxifying pathways are involved in this process, which are

comprised of many enzymes that are responsible for reducing and

cushioning the damage generated by cytotoxic compounds generated

by adverse growth conditions (Ghosh, 2017; Zhou et al., 2018).

Recent studies have shown that resistance to infection by A. avus in

maize is a trait controlled by multiple genes, however, the behavior of

these genes reported in hybrids is still unknown in native lines that are

considered a great source of genomic wealth and that have adapted to

different growth conditions such as temperature, altitude, humidity,

among others, prevailing from generation to generation (Rajasekaran

et al., 2019). It is important to know the natural response mechanisms

of plants to stress, to nd varieties that are resistant to unfavorable

growth conditions, minimizing production losses and contamination

of seeds by fungi and damage to the health of those who consume the

products.

Conclusions

Faced with the infection of Oaxacan maize coleoptiles by

Aspergillus avus, there was a decrease in total proteins and an

increase in the glyoxalase I response in both gene expression and

enzymatic activity in samples 1 and 5.

The high activity of the enzyme and expression of the gene

participate as a response to the infection of native maize, while low

concentrations of the enzyme and low expression to susceptibility.

However, the results should be analyzed with subsequent resistance

or susceptibility tests.

Literature cited

Álvarez-Gerding X., Cortés-Bullemore R., Medina C., Romero-Romero J. L.,

Inostroza-Blancheteau C., Aquea F. & Arce-Johnson P. (2015). Improved

salinity tolerance in Carrizo Citrange Rootstock through overexpression

of glyoxalase system genes. BioMed Research International, 827951.

https://doi.org/10.1155/2015/827951

Aragón C. F., Taba S, Hernández J. M., Figueroa J. D. & Serrano V. (2006).

Actualización de la información sobre los maíces criollos de Oaxaca.

Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias,

Informe nal SNIB-CONABIO proyecto No. CS002 México D. F. http://

www.conabio.gob.mx/institucion/proyectos/resultados/InfCS002.pdf

Arteaga M. C., Moreno-Letelier A., Mastretta-Yanes A., Vázquez-Lobo A.,

Breña-Ochoa A., Moreno-Estrada A., Eguiarte L. E. & Piñero D. (2016).

Genomic variation in recently collected maize landraces from Mexico.

Genomics Data, 7: 38-45. https://doi.org/10.1016/j.gdata.2015.11.002

Bandyopadhyay R., Ortega-Beltrán A., Akande A., Mutegi C., Atehnkeng J.,

Kaptoge L., Senghor A. L., Adhikari B. N. & Cotty P. J. (2016). Biological

control of aatoxins in Africa: current status and potential challenges in

the face of climate change. World Mycitoxin Journal, 9(5): 771-789.

https://doi.org/10.3920/WMJ2016.2130

Bania I. and Mahanta R. (2012). Evaluation of peroxidases from

various plant sources. International Journal of Scientic and

Research Publications, 2(5). http://citeseerx.ist.psu.edu/viewdoc/

download?doi=10.1.1.387.3615&rep=rep1&type=pdf

Baker R. L., Brown R. L., Chen Z. Y., Cleveland T. E. & Fakhoury A. M.

(2009). A maize lectin-like protein with antifungal activity against

Aspergillus avus. Journal of food protection, 72(1): 120-127. https://doi.

org/10.4315/0362-028X-72.1.120

Ben M. R., El-Omari R., El-Mourabit N., Bouargalne Y. & NHIRI M. (2018).

Changes in the antioxidant and glyoxalase enzyme activities in leaves of

two Moroccan sorghum ecotypes with differential tolerance to nitrogen

stress. Australian Journal of Crop Science, 12(8): 1280-1287. https://

www.cropj.com/mrid_12_8_2018_1280_1287.pdf

Borysiuk K., Ostaszewska-Bugajska M., Vaultier M-N, Hasenfratz-Sauder M-P &

Szal B. (2018). Enhanced formation of methylglyoxal-derived advanced

glycation end products in Arabidopsis under Ammonium Nutrition.

Frontiers in Plant Science, 9: 667. https://doi.org/10.3389/fpls.2018.00667

Cabrera T. J. M., Carballo A. & Aragón-Cuevas F. (2015). Evaluación agronómica

de maíces raza Zapalote chico en la región Istmeña de Oaxaca. Revista

Mexicana Ciencias Agrícolas, 11: 2075-2082. https://doi.org/10.29312/

remexca.v0i11.775

Chen Z. Y., Brown R. L., Damann K. E. & Cleveland T. E. (2004). Identication

of a maize kernel stress-related protein and its effect on aatoxin

accumulation. Phytopathology, 94(9): 938-945. https://doi.org/10.1094/

PHYTO.2004.94.9.938

Chen, Z.-Y., Brown R. L., Damann K. E. & Cleveland T. E. (2007). Identication

of maize kernel endosperm proteins associated with resistance to aatoxin

contamination by Aspergillus avus. Phytopathology, 97(9): 1094–1103.

https://doi.org/10.1094/PHYTO-97-9-1094

Chomczynski P. and Sacchi N. (1987). Single-step method of RNA isolation

by acid guanidinium thiocyanate-phenol-chloroform extraction.

Analytical Biochemistry, 162(1):156-9. https://doi.org/10.1016/0003-

2697(87)90021-2

Fernández S. R., Morales L. A. & A. Gálvez M. (2013). Importancia de los maíces

nativos de México en la dieta nacional. Una revisión indispensable.

Revista Fitotecnia Mexicana, 36(3-A): 275-283. http://www.scielo.org.

mx/pdf/rfm/v36s3-a/v36s3-aa4.pdf

Fountain J. C., Chen Z-Y, Scully B. T., Kamerait R. C., Lee R. D. & Guo B. (2010).

Pathogenesis-related gene expressions in different maize genotypes

under drought stressed conditions. African Journal Plant Science, 4(11):

433-440. https://academicjournals.org/article/article1380126077_

Fountain%20et%20al.pdf

Ghosh A. (2017). Genome-wide identication of glyoxalase genes in Medicago

truncatula and their expression proling in response to various

developmental and environmental stimuli. Frontiers in Plant Science, 8:

836. https://doi.org/10.3389/fpls.2017.00836

Ghosh A., Kushwana H. R., Hasan M. R., Pareek A., Sopory S. K. & Singla-Pareek

S. L. (2016). Presence of unique glyoxalase III proteins in plants indicates

the existence of shorter route for methylglyoxal detoxication. Scientic

Reports, 6:18358. https://doi.org/10.1038/srep18358

Hasanuzzaman M., Nahar K., Hossain Md. S., Mahmud J. A., Rahman A., Inafuku

M., Oku H. & Fujita M. (2017a). Coordinated actions of glyoxalase and

antioxidant defense systems in conferring abiotic stress tolerance in

plants. International Journal Molecular Sciences, 18(1): 200. https://doi.

org/10.3390/ijms18010200

Hasanuzzaman M., Nahar K., Hossain Md. S., Anee T. I., Parvin K. & Fujita M.

(2017b). Nitric oxide pretreatment enhances antioxidant defense and

glyoxalase systems to confer PEG-induced oxidative stress in rapeseed.

Journal of Plant Interaction, 12(1): 323-331. https://doi.org/10.1080/17

429145.2017.1362052

Kato Y. T. A., Mapes C., Mera L. M., Serratos J. A. & Bye R. A. (2009). Origen y

diversicación del maíz; Una revisión analítica. UNAM: México: 115 pp.

https://issuu.com/perrasdelmal/docs/origen_y_diversif._del_maiz

Kaur C., Sharma S., Hasan M. R., Pareek A., Singla-Pareek S. L. & Sopory S.

K. (2017). Characteristic variations and similarities in biochemical,

molecular and functional Properties of glyoxalases across Prokaryotes and

Eukaryotes. International Journal of Molecular Sciences, 18:250. https://

doi.org/10.3390/ijms18040250

Li Z-G. (2016). Methylglyoxal and glyoxalase system in plants: old players, new

concepts. The Botanical Review, 82: 183-203. https://doi.org/10.1007/

s12229-016-9167-9

Rosado O. A. and Villasante S. B. (2021). Los herederos del maíz. Instituto

Nacional de los Pueblos Indígenas, Ciudad de México. https://www.gob.

mx/cms/uploads/attachment/le/658352/Libro-Los-herederos-del-maiz-

INPI.pdf

Martínez P. H. Y., Hernández S., Reyes C. A. & Vázquez-Carrillo G. (2013). El

género Aspergillus y sus micotoxinas de maíz en México: problemática y

perspectivas. Revista Mexicana de Fitopatología, 31(2): 126-146. http://

www.scielo.org.mx/pdf/rm/v31n2/v31n2a5.pdf

Orozco-Ramírez Q., Ross-Ibarra J., Santacruz-Varela A. & Brush S. (2016). Maize

diversity associated with social origin and environmental variation in

Southern Mexico. Heredity, 116(5): 477-484. https://doi.org/10.1038/

hdy.2016.10

Rajasekaran K., Sayler R. J., Majumdar R., Sickler C. M. & Cary J. W. (2019).

Inhibition of Aspergillus avus growth and aatoxin production in

transgenic maize expressing the α-amylase inhibitor from Lablab

purpureus L. Journal of Visualized Experiments, 144. https://doi.

org/10.3791/59169

Rohman Md. M., Talukder M. Z. A., Hossain M. G., Uddin M. S., Amiruzzaman

M., Biswas A., Ahsan A. F. M. & Chowdhury M. A. Z. (2016). Saline

sensitivity leads to oxidative stress and increases the antioxidants in

This scientic publication in digital format is a continuation of the Printed Review: Legal Deposit pp 196802ZU42, ISSN 0378-7818.

Varapizuela-Sánchez et al. Rev. Fac. Agron. (LUZ). 2022, 39(4): e2239466-6 |

presence of proline and betaine in maize (Zea mays L.) inbred. Plants

Omics Journal, 9(1): 35-47. omics.com/rohman_9_1_2016-35_47.pdf

Sadiq I., Fanucchi F., Paparelli E., Alpi E., Bachi A., Alpi A. & Perata

P. (2011). Proteomic identication of differentially expressed

proteins in the anoxic rice coleoptile. Journal of Plant Physiology,

168:2234-2243. https://doi.org/10.1016/j.jplph.2011.07.009

Servicio de Información Agroalimentaria y Pesquera. SIAP. (2021).

Anuario estadístico de la producción agrícola. Consultado el 9 de mayo

de 2022. https://nube.siap.gob.mx/cierreagricola/

Schneider C., Rasband W. & Eliceiri, K. (2012). NIH Image to ImageJ: 25 years of

image analysis. Nature Methods, 9 (7): 671–675. https://doi.org/10.1038/

nmeth.2089

Turra G. L., Agostini R. B., Fauguel C. M., Presello D. A., Andreo C. S., González

J. M. & Campos-Bermudez V. A. (2015). Structure of the novel monomeric

glyoxalase I from Zea mays. Acta Crystallogr D Biol Crystallogr, 71(10):

2009-2020. https://doi.org/10.1107/S1399004715015205

Zhou Z-H, Wang Y., Ye X-Y & Li Z-G. (2018). Signaling molecule hydrogen

sulde improves seed germination and seedling growth of Maize (Zea

mays L.) under high temperature by inducing antioxidant system and

osmolyte biosynthesis. Frontiers in Plant Science, 9: 1288. https://doi.

org/10.3389/fpls.2018.01288

Varapizuela S. C. F., Sánchez M. M. A. & Pérez S. A. D. (2019). Análisis de

la actividad enzimática de peroxidasas en maíces nativos de Oaxaca

infectados por Aspergillus parasiticus. Revista Ingeniantes, 2(2): 75-79.

https://citt.itsm.edu.mx/ingeniantes/pdfversion/ingeniantes6no2vol2-esp.

pdf